Mechanical Forces for in vitro Endothelial Cell Biology

biologiayctma

A Information to Extract Spinal Twine for Translational Stem Cell Biology Analysis: Comparative Evaluation of Grownup Human, Porcine, and Rodent Spinal Twine Stem Cells

Bettering the scientific translation of animal-based neural stem/progenitor cell (NSPC) therapies to people requires an understanding of intrinsic human and animal cell traits. We report a novel in vitro methodology to evaluate spinal wire NSPCs from a small (rodent) and enormous (porcine) animal mannequin compared to human NSPCs.

 To extract reside grownup human, porcine, and rodent spinal wire tissue, we illustrate a method utilizing an anterior or posterior strategy that was simulated in a porcine mannequin.

The preliminary enlargement of major NSPCs is carried out utilizing the neurosphere assay adopted by a pharmacological therapy section throughout which NSPCs derived from people, porcines, and rodents are assessed in parallel utilizing the identical outlined parameters.

 Utilizing this mannequin, NSPCs from all species demonstrated multi-lineage differentiation and self-renewal. Importantly, these strategies present situations to allow the direct comparability of species-dependent cell conduct in response to particular exogenous alerts. 

The Significance of Mechanical Forces for in vitro Endothelial Cell Biology

Blood and lymphatic vessels are lined by endothelial cells which consistently work together with their luminal and abluminal extracellular environments. These interactions confer bodily forces on the endothelium, comparable to shear stress, stretch and stiffness, to mediate organic responses. 

  • These bodily forces are sometimes altered throughout illness, driving irregular endothelial cell conduct and pathology. Due to this fact, it’s important that we perceive the mechanisms by which endothelial cells reply to bodily forces.
  • Historically, endothelial cells in tradition are grown within the absence of circulation on stiff substrates comparable to plastic or glass.
  • These cells usually are not subjected to the bodily forces that endothelial cells endure in vivo, thus the outcomes of those experiments usually don’t mimic these noticed within the physique.
  • The sector of vascular biology now understand that an intricate evaluation of endothelial signaling mechanisms requires complicated in vitro techniques to imitate in vivo situations.
  • Right here, we’ll evaluate what is understood in regards to the mechanical forces that information endothelial cell conduct after which talk about the developments in endothelial cell tradition fashions designed to higher mimic the in vivo vascular microenvironment.
  • A wider software of those applied sciences will present extra biologically related data from cultured cells which will probably be reproducible to situations discovered within the physique.
biologiayctma
biologiayctma

PRKCA Antibody

1-CSB-PA898666
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PRKCA. Recognizes PRKCA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:200-1:1000, IHC:1:25-1:100

PRKCA Antibody

1-CSB-PA937356
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PRKCA. Recognizes PRKCA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

PRKCA Antibody

CSB-PA557375-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline , pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antigen Affinity Purified
Description: A polyclonal antibody against PRKCA. Recognizes PRKCA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

PRKCA Antibody

CSB-PA557375-100ul 100ul
EUR 314
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline , pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antigen Affinity Purified
Description: A polyclonal antibody against PRKCA. Recognizes PRKCA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

PRKCA Antibody

1-CSB-PA566617
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PRKCA. Recognizes PRKCA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:200-1:1000, IHC:1:25-1:100

PRKCA Antibody

1-CSB-PA15859A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PRKCA. Recognizes PRKCA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

PRKCA Antibody

1-CSB-PA105506
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PRKCA. Recognizes PRKCA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

PRKCA Antibody

CSB-PA018699KA01HU-
EUR 335
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against PRKCA. Recognizes PRKCA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

PRKCA Antibody

CSB-PA018699KA01HU-100ul 100ul
EUR 389
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against PRKCA. Recognizes PRKCA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

PRKCA Antibody

1-CSB-PA030237
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against PRKCA. Recognizes PRKCA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/5000

PRKCA Antibody

1-CSB-PA030238
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against PRKCA. Recognizes PRKCA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/5000

PRKCA Antibody

1-CSB-PA030239
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against PRKCA. Recognizes PRKCA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/10000

PRKCA Conjugated Antibody

C32053 100ul
EUR 397

Mouse Prkca Antibody

abx027933-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Mouse Prkca Antibody

abx027933-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

PRKCA (pT497) Antibody

abx217939-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

PRKCA (pS657) Antibody

abx217940-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

PRKCA (pY658) Antibody

abx333503-100ul 100 ul
EUR 467
  • Shipped within 5-10 working days.

Anti-PRKCA antibody

STJ25125 100 µl
EUR 277
Description: Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. This kinase has been reported to play roles in many different cellular processes, such as cell adhesion, cell transformation, cell cycle checkpoint, and cell volume control. Knockout studies in mice suggest that this kinase may be a fundamental regulator of cardiac contractility and Ca(2+) handling in myocytes.

Anti-PRKCA antibody

STJ112958 100 µl
EUR 457
Description: Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. This kinase has been reported to play roles in many different cellular processes, such as cell adhesion, cell transformation, cell cycle checkpoint, and cell volume control. Knockout studies in mice suggest that this kinase may be a fundamental regulator of cardiac contractility and Ca(2+) handling in myocytes.

Anti-PRKCA antibody

STJ115305 100 µl
EUR 277
Description: Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. This kinase has been reported to play roles in many different cellular processes, such as cell adhesion, cell transformation, cell cycle checkpoint, and cell volume control. Knockout studies in mice suggest that this kinase may be a fundamental regulator of cardiac contractility and Ca(2+) handling in myocytes.

Prkca/ Rat Prkca ELISA Kit

ELI-04515r 96 Tests
EUR 886

PRKCA siRNA

20-abx929759
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PRKCA siRNA

20-abx929760
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Phospho-PRKCA (Thr497) Antibody

AF8395 200ul
EUR 376
Description: PRKCA (Phospho-Thr497) Antibody detects endogenous levels of PRKCA only when phosphorylated at Thr497.

Phospho-PRKCA (Ser657) Antibody

AF8396 200ul
EUR 376
Description: PRKCA (Phospho-Ser657) Antibody detects endogenous levels of PRKCA only when phosphorylated at Ser657.

Phospho-PRKCA (Tyr195) Antibody

AF7240 200ul
EUR 376
Description: Phospho-PRKCA (Tyr195) Antibody detects endogenous levels of PRKCA only when phosphorylated at Tyr195.

PRKCA (Phospho- Thr497) Antibody

ABF8395 100 ug
EUR 438

PRKCA (Phospho- Ser657) Antibody

ABF8396 100 ug
EUR 438

PRKCA (Phospho-Tyr195) Antibody

13096-100ul 100ul
EUR 252

PRKCA (Phospho-Tyr195) Antibody

13096-50ul 50ul
EUR 187

PRKCA (Ab-657) Antibody

CSB-PA589165-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against PRKCA (Ab-657). Recognizes PRKCA (Ab-657) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

PRKCA (Ab-657) Antibody

CSB-PA589165-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against PRKCA (Ab-657). Recognizes PRKCA (Ab-657) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

PRKCA Antibody, HRP conjugated

1-CSB-PA15859B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PRKCA. Recognizes PRKCA from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PRKCA Antibody, FITC conjugated

1-CSB-PA15859C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PRKCA. Recognizes PRKCA from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PRKCA Antibody, Biotin conjugated

1-CSB-PA15859D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PRKCA. Recognizes PRKCA from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Phospho-PRKCA (Tyr658) Antibody

CSB-PA060190-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
  • Show more
Description: A polyclonal antibody against Phospho-PRKCA (Tyr658). Recognizes Phospho-PRKCA (Tyr658) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

Phospho-PRKCA (Tyr658) Antibody

CSB-PA060190-100ul 100ul
EUR 362
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
  • Show more
Description: A polyclonal antibody against Phospho-PRKCA (Tyr658). Recognizes Phospho-PRKCA (Tyr658) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

Phospho-PRKCA (Y657) Antibody

1-CSB-PA030235
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-PRKCA (Y657). Recognizes Phospho-PRKCA (Y657) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

Phospho-PRKCA (T638) Antibody

1-CSB-PA030236
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-PRKCA (T638). Recognizes Phospho-PRKCA (T638) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000

PRKCA Blocking Peptide

AF7740-BP 1mg
EUR 195

PRKCA cloning plasmid

CSB-CL018699HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2019
  • Sequence: ATGGCTGACGTTTTCCCGGGCAACGACTCCACGGCGTCTCAGGACGTGGCCAACCGCTTCGCCCGCAAAGGGGCGCTGAGGCAGAAGAACGTGCACGAGGTGAAGGACCACAAATTCATCGCGCGCTTCTTCAAGCAGCCCACCTTCTGCAGCCACTGCACCGACTTCATCTGGG
  • Show more
Description: A cloning plasmid for the PRKCA gene.

PRKCA Rabbit pAb

A0267-100ul 100 ul
EUR 308

PRKCA Rabbit pAb

A0267-200ul 200 ul
EUR 459

PRKCA Rabbit pAb

A0267-20ul 20 ul
EUR 183

PRKCA Rabbit pAb

A0267-50ul 50 ul
EUR 223

PRKCA Rabbit mAb

A11107-100ul 100 ul
EUR 459

PRKCA Rabbit mAb

A11107-200ul 200 ul
EUR 686

PRKCA Rabbit mAb

A11107-20ul 20 ul Ask for price

PRKCA Rabbit mAb

A11107-50ul 50 ul
EUR 308

PRKCA Rabbit pAb

A13342-100ul 100 ul
EUR 308

PRKCA Rabbit pAb

A13342-200ul 200 ul
EUR 459

PRKCA Rabbit pAb

A13342-20ul 20 ul
EUR 183

PRKCA Rabbit pAb

A13342-50ul 50 ul
EUR 223

PRKCA Blocking Peptide

DF6070-BP 1mg
EUR 195

Recombinant Human PRKCA

P0211 100ug
EUR 522.36
  • Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose
  • Reconstitution: Sterile distilled water
  • Purity: Greater than 95% by SDS-PAGE gel analyses
  • Uniprot ID: P17252
Description: Recombinant Human protein for PRKCA

PRKCA (Phospho-Tyr195) Conjugated Antibody

C13096 100ul
EUR 397

Anti-PKC alpha/PRKCA Antibody

PB9318 100ug/vial
EUR 334

Anti-PKC alpha/PRKCA Antibody

PA1065 100ug/vial
EUR 334

Anti-Phospho-PRKCA-(S226) antibody

STJ113497 100 µl
EUR 393
Description: Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. This kinase has been reported to play roles in many different cellular processes, such as cell adhesion, cell transformation, cell cycle checkpoint, and cell volume control. Knockout studies in mice suggest that this kinase may be a fundamental regulator of cardiac contractility and Ca(2+) handling in myocytes.

Anti-Phospho-PRKCA-(S319) antibody

STJ117877 100 µl
EUR 393
Description: Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. This kinase has been reported to play roles in many different cellular processes, such as cell adhesion, cell transformation, cell cycle checkpoint, and cell volume control. Knockout studies in mice suggest that this kinase may be a fundamental regulator of cardiac contractility and Ca(2+) handling in myocytes.

Polyclonal Mouse Prkca Antibody (N-term)

APR03938G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Mouse Prkca (N-term). This antibody is tested and proven to work in the following applications:

Protein Kinase C Alpha (PRKCA) Antibody

20-abx125382
  • EUR 592.00
  • EUR 857.00
  • EUR 411.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Protein Interacting With Prkca 1 Antibody

20-abx114793
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Protein Kinase C Alpha (PRKCA) Antibody

abx116998-100ug 100 ug
EUR 467
  • Shipped within 5-10 working days.

Protein Kinase C Alpha (PRKCA) Antibody

20-abx000652
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Protein Kinase C Alpha (PRKCA) Antibody

abx037155-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Protein Kinase C Alpha (PRKCA) Antibody

abx034005-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Protein Kinase C Alpha (PRKCA) Antibody

abx034005-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Protein kinase C alpha (PRKCA) Antibody

20-abx326423
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Protein kinase C alpha (PRKCA) Antibody

20-abx327945
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Protein kinase C alpha (PRKCA) Antibody

20-abx329052
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Protein kinase C alpha (PRKCA) Antibody

abx332239-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Protein kinase C alpha (PRKCA) Antibody

abx332517-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Protein kinase C alpha (PRKCA) Antibody

20-abx241740
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Protein kinase C alpha (PRKCA) Antibody

20-abx241741
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Protein kinase C alpha (PRKCA) Antibody

20-abx241990
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Protein kinase C alpha (PRKCA) Antibody

20-abx242373
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Protein Kinase C Alpha (PRKCA) Antibody

20-abx302139
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Phospho-PRKCA-S657/Y658 antibody

STJ11101090 100 µl
EUR 393
Description: Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. This kinase has been reported to play roles in many different cellular processes, such as cell adhesion, cell transformation, cell cycle checkpoint, and cell volume control. Knockout studies in mice suggest that this kinase may be a fundamental regulator of cardiac contractility and Ca(2+) handling in myocytes.

Anti-Phospho-PRKCA/PRKCB-(T641) antibody

STJ22341 100 µl
EUR 393
Description: Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. This protein kinase has been reported to be involved in many different cellular functions, such as B cell activation, apoptosis induction, endothelial cell proliferation, and intestinal sugar absorption. Studies in mice also suggest that this kinase may also regulate neuronal functions and correlate fear-induced conflict behavior after stress. Alternatively spliced transcript variants encoding distinct isoforms have been reported.

Human PRKCA ELISA Kit

ELA-E1380h 96 Tests
EUR 824

PRKCA ELISA KIT|Human

EF005341 96 Tests
EUR 689

Human PRKCA shRNA Plasmid

20-abx953748
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse PRKCA shRNA Plasmid

20-abx972057
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PRKCA Recombinant Protein (Human)

RP084903 100 ug Ask for price

PRKCA Recombinant Protein (Rat)

RP222059 100 ug Ask for price

PRKCA Recombinant Protein (Mouse)

RP164438 100 ug Ask for price

Polyclonal PRKCA / PKC-Alpha Antibody (aa1-250)

APR03163G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PRKCA / PKC-Alpha (aa1-250). This antibody is tested and proven to work in the following applications:

Monoclonal PRKCA Antibody (monoclonal) (M01), Clone: 2F11

AMM03937G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human PRKCA (monoclonal) (M01). The antibodies are raised in mouse and are from clone 2F11. This antibody is applicable in WB, IHC and IF, E

Phospho-threonine [T497] PKCalpha (PRKCA) polyclonal antibody

ABP-PAB-11667 100 ug Ask for price
    • Product line: Kinases
    • Brand:

Protein Kinase C Alpha Type (PRKCA) Antibody

20-abx133286
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Protein Kinase C Alpha Type (PRKCA) Antibody

abx033114-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Protein Kinase C Alpha Type (PRKCA) Antibody

abx033114-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Protein Kinase C Alpha Type (PRKCA) Antibody

abx011355-100ug 100 ug
EUR 425
  • Shipped within 5-10 working days.

Protein Kinase C Alpha Type (PRKCA) Antibody

20-abx011394
  • EUR 439.00
  • EUR 258.00
  • EUR 77.00
  • 100 ug
  • 50 ug
  • 5 ug
  • Shipped within 5-10 working days.

Protein Kinase C Alpha Type (PRKCA) Antibody

20-abx012800
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Protein Kinase C Alpha (PRKCA) Antibody (HRP)

20-abx314446
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Protein Kinase C Alpha (PRKCA) Antibody (FITC)

20-abx314447
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Protein Kinase C Alpha (PRKCA) Antibody (Biotin)

20-abx314448
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Rabbit Anti-PRKCA monoclonal antibody, clone KG1075

DCABH-6947 100 ul
EUR 777

Phospho-PRKCA (Thr497) Blocking Peptide

AF8395-BP 1mg
EUR 195

Phospho-PRKCA (Ser657) Blocking Peptide

AF8396-BP 1mg
EUR 195

Phospho-PRKCA (Tyr195) Blocking Peptide

AF7240-BP 1mg
EUR 195

Human PRKCA-binding protein (PICK1)

1-CSB-RP054454h
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 48.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human PRKCA-binding protein(PICK1),partial expressed in E.coli

PRKCA ORF Vector (Human) (pORF)

ORF028302 1.0 ug DNA
EUR 405

h PRKCA inducible lentiviral particles

LVP219 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, PRKCA, is fully sequence verified and matched to NCBI accession ID: NM_002737

Prkca ORF Vector (Rat) (pORF)

ORF074021 1.0 ug DNA
EUR 506

Prkca ORF Vector (Mouse) (pORF)

ORF054814 1.0 ug DNA
EUR 506

PRKCA ELISA Kit (Human) (OKCD07796)

OKCD07796 96 Wells
EUR 936
Description: Description of target: Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. This kinase has been reported to play roles in many different cellular processes, such as cell adhesion, cell transformation, cell cycle checkpoint, and cell volume control. Knockout studies in mice suggest that this kinase may be a fundamental regulator of cardiac contractility and Ca(2+) handling in myocytes.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 12.2pg/mL

PRKCA ELISA Kit (Mouse) (OKCD07797)

OKCD07797 96 Wells
EUR 818
Description: Description of target: Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab);Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 0.31ng/mL

PRKCA ELISA Kit (Rat) (OKCD07798)

OKCD07798 96 Wells
EUR 1001
Description: Description of target: Displays Ca+2 dependent protein kinase activity;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 0.117ng/mL

PRKCA ELISA Kit (Rat) (OKCA00995)

OKCA00995 96 Wells
EUR 917
Description: Description of target: Calcium-activated, phospholipid- and diacylglycerol (DAG)-dependent serine/threonine-protein kinase that is involved in positive and negative regulation of cell proliferation, apoptosis, differentiation, migration and adhesion, cardiac hypertrophy, angiogenesis, platelet function and inflammation, by directly phosphorylating targets such as RAF1, BCL2, CSPG4, TNNT2/CTNT, or activating signaling cascades involving MAPK1/3 (ERK1/2) and RAP1GAP. Depending on the cell type, is involved in cell proliferation and cell growth arrest by positive and negative regulation of the cell cycle. Can promote cell growth by phosphorylating and activating RAF1, which mediates the activation of the MAPK/ERK signaling cascade, and/or by up-regulating CDKN1A, which facilitates active cyclin-dependent kinase (CDK) complex formation. In cells stimulated by the phorbol ester PMA, can trigger a cell cycle arrest program which is associated with the accumulation of the hyper-phosphorylated growth-suppressive form of RB1 and induction of the CDK inhibitors CDKN1A and CDKN1B. Depending on the cell type, exhibits anti-apoptotic function and protects cells from apoptosis by suppressing the p53/TP53-mediated activation of IGFBP3, or mediates anti-apoptotic action by phosphorylating BCL2. During macrophage differentiation induced by macrophage colony-stimulating factor (CSF1), is translocated to the nucleus and is associated with macrophage development. After wounding, translocates from focal contacts to lamellipodia and participates in the modulation of desmosomal adhesion. Plays a role in cell motility by phosphorylating CSPG4, which induces association of CSPG4 with extensive lamellipodia at the cell periphery and polarization of the cell accompanied by increases in cell motility. Negatively regulates myocardial contractility and positively regulates angiogenesis, platelet aggregation and thrombus formation in arteries. Mediates hypertrophic growth of neonatal cardiomyocytes, in part through a MAPK1/3 (ERK1/2)-dependent signaling pathway, and upon PMA treatment, is required to induce cardiomyocyte hypertrophy up to heart failure and death, by increasing protein synthesis, protein-DNA ratio and cell surface area. Regulates cardiomyocyte function by phosphorylating cardiac troponin T (TNNT2/CTNT), which induces significant reduction in actomyosin ATPase activity, myofilament calcium sensitivity and myocardial contractility. In angiogenesis, is required for full endothelial cell migration, adhesion to vitronectin (VTN), and vascular endothelial growth factor A (VEGFA)-dependent regulation of kinase activation and vascular tube formation. Involved in the stabilization of VEGFA mRNA at post-transcriptional level and mediates VEGFA-induced cell proliferation. In the regulation of calcium-induced platelet aggregation, mediates signals from the CD36/GP4 receptor for granule release, and activates the integrin heterodimer ITGA2B-ITGB3 through the RAP1GAP pathway for adhesion. During response to lipopolysaccharides (LPS), may regulate selective LPS-induced macrophage functions involved in host defense and inflammation. But in some inflammatory responses, may negatively regulate NF-kappa-B-induced genes, through IL1A-dependent induction of NF-kappa-B inhibitor alpha (NFKBIA/IKBA). Upon stimulation with 12-O-tetradecanoylphorbol-13-acetate (TPA), phosphorylates EIF4G1, which modulates EIF4G1 binding to MKNK1 and may be involved in the regulation of EIF4E phosphorylation. Phosphorylates KIT, leading to inhibition of KIT activity. Phosphorylates ATF2 which promotes cooperation between ATF2 and JUN, activating transcription.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 3.9 pg/mL

Prkca ELISA Kit (Rat) (OKEH04840)

OKEH04840 96 Wells
EUR 662
Description: Description of target: Displays Ca+2 dependent protein kinase activity;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.172 ng/mL

Prkca ELISA Kit (Mouse) (OKEH04841)

OKEH04841 96 Wells
EUR 662
Description: Description of target: Calcium-activated, phospholipid- and diacylglycerol (DAG)-dependent serine/threonine-protein kinase that is involved in positive and negative regulation of cell proliferation, apoptosis, differentiation, migration and adhesion, cardiac hypertrophy, angiogenesis, platelet function and inflammation, by directly phosphorylating targets such as RAF1, BCL2, CSPG4, TNNT2/CTNT, or activating signaling cascades involving MAPK1/3 (ERK1/2) and RAP1GAP. Depending on the cell type, is involved in cell proliferation and cell growth arrest by positive and negative regulation of the cell cycle. Can promote cell growth by phosphorylating and activating RAF1, which mediates the activation of the MAPK/ERK signaling cascade, and/or by up-regulating CDKN1A, which facilitates active cyclin-dependent kinase (CDK) complex formation. In cells stimulated by the phorbol ester PMA, can trigger a cell cycle arrest program which is associated with the accumulation of the hyper-phosphorylated growth-suppressive form of RB1 and induction of the CDK inhibitors CDKN1A and CDKN1B. Depending on the cell type, exhibits anti-apoptotic function and protects cells from apoptosis by suppressing the p53/TP53-mediated activation of IGFBP3, or mediates anti-apoptotic action by phosphorylating BCL2. During macrophage differentiation induced by macrophage colony-stimulating factor (CSF1), is translocated to the nucleus and is associated with macrophage development. After wounding, translocates from focal contacts to lamellipodia and participates in the modulation of desmosomal adhesion. Plays a role in cell motility by phosphorylating CSPG4, which induces association of CSPG4 with extensive lamellipodia at the cell periphery and polarization of the cell accompanied by increases in cell motility. Negatively regulates myocardial contractility and positively regulates angiogenesis, platelet aggregation and thrombus formation in arteries. Mediates hypertrophic growth of neonatal cardiomyocytes, in part through a MAPK1/3 (ERK1/2)-dependent signaling pathway, and upon PMA treatment, is required to induce cardiomyocyte hypertrophy up to heart failure and death, by increasing protein synthesis, protein-DNA ratio and cell surface area. Regulates cardiomyocyte function by phosphorylating cardiac troponin T (TNNT2/CTNT), which induces significant reduction in actomyosin ATPase activity, myofilament calcium sensitivity and myocardial contractility. In angiogenesis, is required for full endothelial cell migration, adhesion to vitronectin (VTN), and vascular endothelial growth factor A (VEGFA)-dependent regulation of kinase activation and vascular tube formation. Involved in the stabilization of VEGFA mRNA at post-transcriptional level and mediates VEGFA-induced cell proliferation. In the regulation of calcium-induced platelet aggregation, mediates signals from the CD36/GP4 receptor for granule release, and activates the integrin heterodimer ITGA2B-ITGB3 through the RAP1GAP pathway for adhesion. During response to lipopolysaccharides (LPS), may regulate selective LPS-induced macrophage functions involved in host defense and inflammation. But in some inflammatory responses, may negatively regulate NF-kappa-B-induced genes, through IL1A-dependent induction of NF-kappa-B inhibitor alpha (NFKBIA/IKBA). Upon stimulation with 12-O-tetradecanoylphorbol-13-acetate (TPA), phosphorylates EIF4G1, which modulates EIF4G1 binding to MKNK1 and may be involved in the regulation of EIF4E phosphorylation. Phosphorylates KIT, leading to inhibition of KIT activity. Phosphorylates ATF2 which promotes cooperation between ATF2 and JUN, activating transcription.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15.6 pg/mL

PRKCA ELISA Kit (Bovine) (OKEH06643)

OKEH06643 96 Wells
EUR 779
Description: Description of target: Calcium-activated, phospholipid- and diacylglycerol (DAG)-dependent serine/threonine-protein kinase that is involved in positive and negative regulation of cell proliferation, apoptosis, differentiation, migration and adhesion, cardiac hypertrophy, angiogenesis, platelet function and inflammation, by directly phosphorylating targets such as RAF1, BCL2, CSPG4, TNNT2/CTNT, or activating signaling cascades involving MAPK1/3 (ERK1/2) and RAP1GAP. Depending on the cell type, is involved in cell proliferation and cell growth arrest by positive and negative regulation of the cell cycle. Can promote cell growth by phosphorylating and activating RAF1, which mediates the activation of the MAPK/ERK signaling cascade, and/or by up-regulating CDKN1A, which facilitates active cyclin-dependent kinase (CDK) complex formation. In cells stimulated by the phorbol ester PMA, can trigger a cell cycle arrest program which is associated with the accumulation of the hyper-phosphorylated growth-suppressive form of RB1 and induction of the CDK inhibitors CDKN1A and CDKN1B. Depending on the cell type, exhibits anti-apoptotic function and protects cells from apoptosis by suppressing the p53/TP53-mediated activation of IGFBP3, or mediates anti-apoptotic action by phosphorylating BCL2. During macrophage differentiation induced by macrophage colony-stimulating factor (CSF1), is translocated to the nucleus and is associated with macrophage development. After wounding, translocates from focal contacts to lamellipodia and participates in the modulation of desmosomal adhesion. Plays a role in cell motility by phosphorylating CSPG4, which induces association of CSPG4 with extensive lamellipodia at the cell periphery and polarization of the cell accompanied by increases in cell motility. Negatively regulates myocardial contractility and positively regulates angiogenesis, platelet aggregation and thrombus formation in arteries. Mediates hypertrophic growth of neonatal cardiomyocytes, in part through a MAPK1/3 (ERK1/2)-dependent signaling pathway, and upon PMA treatment, is required to induce cardiomyocyte hypertrophy up to heart failure and death, by increasing protein synthesis, protein-DNA ratio and cell surface area. Regulates cardiomyocyte function by phosphorylating cardiac troponin T (TNNT2/CTNT), which induces significant reduction in actomyosin ATPase activity, myofilament calcium sensitivity and myocardial contractility. In angiogenesis, is required for full endothelial cell migration, adhesion to vitronectin (VTN), and vascular endothelial growth factor A (VEGFA)-dependent regulation of kinase activation and vascular tube formation. Involved in the stabilization of VEGFA mRNA at post-transcriptional level and mediates VEGFA-induced cell proliferation. In the regulation of calcium-induced platelet aggregation, mediates signals from the CD36/GP4 receptor for granule release, and activates the integrin heterodimer ITGA2B-ITGB3 through the RAP1GAP pathway for adhesion. During response to lipopolysaccharides (LPS), may regulate selective LPS-induced macrophage functions involved in host defense and inflammation. But in some inflammatory responses, may negatively regulate NF-kappa-B-induced genes, through IL1A-dependent induction of NF-kappa-B inhibitor alpha (NFKBIA/IKBA). Upon stimulation with 12-O-tetradecanoylphorbol-13-acetate (TPA), phosphorylates EIF4G1, which modulates EIF4G1 binding to MKNK1 and may be involved in the regulation of EIF4E phosphorylation. Phosphorylates KIT, leading to inhibition of KIT activity. Phosphorylates ATF2 which promotes cooperation between ATF2 and JUN, activating transcription.;Species reactivity: Bovine;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 27 pg/mL

PRKCA/PRKCB/PRKCD/PRKCE/PRKCH/PRKCQ Polyclonal Antibody

30229-100ul 100ul
EUR 252

PRKCA/PRKCB/PRKCD/PRKCE/PRKCH/PRKCQ Polyclonal Antibody

30229-50ul 50ul
EUR 187

Anti-PRKCA/PRKCB/PRKCD/PRKCE/PRKCH/PRKCQ antibody

STJ119908 100 µl
EUR 277

Phospho-PRKCA-S657/Y658 Rabbit pAb

AP0970-100ul 100 ul
EUR 384

Phospho-PRKCA-S657/Y658 Rabbit pAb

AP0970-200ul 200 ul
EUR 554

Phospho-PRKCA-S657/Y658 Rabbit pAb

AP0970-20ul 20 ul
EUR 183

Phospho-PRKCA-S657/Y658 Rabbit pAb

AP0970-50ul 50 ul
EUR 265

PRKCA sgRNA CRISPR Lentivector set (Human)

K0003901 3 x 1.0 ug
EUR 339

PRKCA sgRNA CRISPR Lentivector set (Human)

K1721501 3 x 1.0 ug
EUR 339

Prkca sgRNA CRISPR Lentivector set (Mouse)

K4855101 3 x 1.0 ug
EUR 339

Prkca sgRNA CRISPR Lentivector set (Rat)

K6807301 3 x 1.0 ug
EUR 339

PRKCA/PRKCB/PRKCD/PRKCE/PRKCH/PRKCQ Polyclonal Conjugated Antibody

C30229 100ul
EUR 397

Protein kinase C alpha Phospho-Tyr657 (PRKCA pY657) Antibody

20-abx327107
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Protein kinase C alpha Phospho-Thr638 (PRKCA pT638) Antibody

20-abx328538
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

PRKCA / PRKCB / PRKCD / PRKCE / PRKCG / PRKCH / PRKCQ / PRKCZ Antibody

20-abx329612
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

PRKCA/PRKCB/PRKCD/PRKCE/PRKCG/PRKCH/PRKCQ/PRKCZ Antibody

1-CSB-PA003800
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against PRKCA/PRKCB/PRKCD/PRKCE/PRKCG/PRKCH/PRKCQ/PRKCZ. Recognizes PRKCA/PRKCB/PRKCD/PRKCE/PRKCG/PRKCH/PRKCQ/PRKCZ from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000

Human PRKCA- binding protein, PICK1 ELISA KIT

ELI-22002h 96 Tests
EUR 824

PRKCA sgRNA CRISPR Lentivector (Human) (Target 1)

K0003902 1.0 ug DNA
EUR 154

PRKCA sgRNA CRISPR Lentivector (Human) (Target 2)

K0003903 1.0 ug DNA
EUR 154

PRKCA sgRNA CRISPR Lentivector (Human) (Target 3)

K0003904 1.0 ug DNA
EUR 154

Bovine PRKCA- binding protein, PICK1 ELISA KIT

ELI-35710b 96 Tests
EUR 928

Mouse PRKCA- binding protein, Pick1 ELISA KIT

ELI-38036m 96 Tests
EUR 865

PRKCA sgRNA CRISPR Lentivector (Human) (Target 1)

K1721502 1.0 ug DNA
EUR 154

PRKCA sgRNA CRISPR Lentivector (Human) (Target 2)

K1721503 1.0 ug DNA
EUR 154

PRKCA sgRNA CRISPR Lentivector (Human) (Target 3)

K1721504 1.0 ug DNA
EUR 154

Prkca sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4855102 1.0 ug DNA
EUR 154

Prkca sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4855103 1.0 ug DNA
EUR 154

Prkca sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4855104 1.0 ug DNA
EUR 154

Prkca sgRNA CRISPR Lentivector (Rat) (Target 1)

K6807302 1.0 ug DNA
EUR 154

Prkca sgRNA CRISPR Lentivector (Rat) (Target 2)

K6807303 1.0 ug DNA
EUR 154

Prkca sgRNA CRISPR Lentivector (Rat) (Target 3)

K6807304 1.0 ug DNA
EUR 154

PRKCA Protein Vector (Human) (pPB-C-His)

PV113206 500 ng
EUR 811

PRKCA Protein Vector (Human) (pPB-N-His)

PV113207 500 ng
EUR 811

PRKCA Protein Vector (Human) (pPM-C-HA)

PV113208 500 ng
EUR 811

Lengthy-read sequencing to know genome biology and cell operate

Figuring out the sequence of DNA and RNA molecules has a big impact on the understanding of cell biology and performance. Latest developments in next-generation short-read sequencing (NGS) applied sciences, drops in value and a decision all the way down to the single-cell degree formed our present view on genome construction and performance. 

Third-generation sequencing (TGS) strategies additional full the data about these processes primarily based on lengthy reads and the flexibility to investigate DNA or RNA at single molecule degree. 

Lengthy-read sequencing offers further prospects to review genome structure and the composition of extremely complicated areas and to find out epigenetic modifications of nucleotide bases at a genome-wide degree. We talk about the ideas and developments of long-read sequencing and its functions in genome biology.

Plant Cell Wall Proteomes: Bioinformatics and Cell Biology Instruments to Assess the Bona Fide Cell Wall Localization of Proteins

The purification of plant cell partitions is difficult as a result of they represent an open compartment which isn’t restricted by a membrane just like the cell organelles. Completely different methods have been established to restrict the contamination by proteins of different compartments in cell wall proteomics research. 

Non-destructive strategies depend on washing intact cells with varied sorts of options with out disrupting the plasma membrane so as to elute cell wall proteins. In distinction, harmful protocols contain the purification of cell partitions previous to the extraction of proteins with salt options.

 In each instances, proteins identified to be intracellular have been recognized by mass spectrometry in cell wall proteomes. The intention of this chapter is to supply instruments to evaluate the subcellular localization of the proteins recognized in cell wall proteomics research, together with:

(1) bioinformatic predictions,

(2) immunocytolocalization of proteins of curiosity on tissue sections and

(3) in muro remark of proteins of curiosity fused to reporter fluorescent proteins by confocal microscopy.

Lastly, a qualitative evaluation of the work may be carried out and the technique used to organize the samples may be optimized if obligatory.  

Zinc Pyrithione

B2201-5.1 10 mM (in 1mL DMSO)
EUR 119
Description: Zinc pyrithione is an antifungal and antibacterial agent disrupting membrane transport by blocking the proton pump.

Zinc Pyrithione

B2201-50 50 mg
EUR 128
Description: Zinc pyrithione is an antifungal and antibacterial agent disrupting membrane transport by blocking the proton pump.

Zinc Pyrithione

B2201-S Evaluation Sample
EUR 81
Description: Zinc pyrithione is an antifungal and antibacterial agent disrupting membrane transport by blocking the proton pump.

Zinc trifluoromethanesulfonate

20-abx184484
  • EUR 439.00
  • EUR 258.00
  • 100 g
  • 25 g
  • Shipped within 1-2 weeks.

Bacitracin (Zinc)

HY-B0278 100mg
EUR 156

Zinc Pyrithione

HY-B0572 500mg
EUR 108

Zinc Protoporphyrin

HY-101193 50mg
EUR 360

Pyrithione zinc

P066-100G 100 g
EUR 218

Pyrithione zinc

P066-10G 10 g
EUR 70

Zinc chloride

ZB1003 250g
EUR 69.87
  • Product category: Biochemicals/Misc. Biochemicals

High Density Zinc

6BCL-QHZn-100 100 ml
EUR 372

High Density Zinc

6BCL-QHZn-25 25 ml
EUR 162

High Density Zinc

6BCL-QHZn-500 500 ml
EUR 1304

Low Density Zinc

6BCL-QLZn-100 100 ml
EUR 372

Low Density Zinc

6BCL-QLZn-25 25 ml
EUR 162

Low Density Zinc

6BCL-QLZn-500 500 ml
EUR 1304

Zinc Assay Kit

55R-1394 100 assays
EUR 673
Description: Assay Kit for detection of Zinc in the research laboratory

Zinc protoporphyrin IX

B6431-10 10 mg
EUR 189

Zinc protoporphyrin IX

B6431-5.1 10 mM (in 1mL DMSO)
EUR 189

Zinc protoporphyrin IX

B6431-50 50 mg
EUR 635

Zinc Assay Kit

abx298876-100Assays 100 Assays
EUR 582
  • Shipped within 5-10 working days.

Zinc acetate dihydrate

GX0226-1KG 1 kg
EUR 86

Zinc acetate dihydrate

GX0226-250G 250 g
EUR 54

Zinc acetate dihydrate

GX0226-5KG 5 kg
EUR 229

Zinc nitrate hexahydrate

GX0843-100G 100 g
EUR 44

Zinc nitrate hexahydrate

GX0843-1KG 1 kg
EUR 98

Zinc nitrate hexahydrate

GX0843-250G 250 g
EUR 54

Zinc nitrate hexahydrate

GX0843-500G 500 g
EUR 70

Zinc nitrate hexahydrate

GX0843-5KG 5 kg
EUR 233

Zinc sulfate monohydrate

GX1311-1KG 1 kg
EUR 68

Zinc sulfate monohydrate

GX1311-5KG 5 kg
EUR 166

Zinc cyclohexanebutyrate, AAS

GX1602-1G 1 g
EUR 86

Zinc chloride, anhydrous

GK8554-100G 100 g
EUR 39

Zinc chloride, anhydrous

GK8554-1KG 1 kg
EUR 62

Zinc chloride, anhydrous

GK8554-250G 250 g
EUR 44

Zinc chloride, anhydrous

GK8554-500G 500 g
EUR 50

Zinc chloride, anhydrous

GK8554-5KG 5 kg
EUR 150

Bacitracin zinc salt

GA1078-1G 1 g
EUR 62

Bacitracin zinc salt

GA1078-5G 5 g
EUR 126

Zinc citrate dihydrate

GE1507-1KG 1 kg
EUR 138

Zinc citrate trihydrate

GE2021-100G 100 g
EUR 50

Zinc citrate trihydrate

GE2021-1KG 1 kg
EUR 126

Zinc citrate trihydrate

GE2021-250G 250 g
EUR 62

Zinc citrate trihydrate

GE2021-500G 500 g
EUR 86

Zinc oxide, 99%

GK2332-1KG 1 kg
EUR 52

Zinc oxide, 99%

GK2332-5KG 5 kg
EUR 106

Zinc carbonate basic

GK2449-1KG 1 kg
EUR 135

Zinc formaldehyde sulfoxylate

GK3576-100G 100 g
EUR 86

Zinc sulfate heptahydrate

GK7296-100G 100 g
EUR 39

Zinc sulfate heptahydrate

GK7296-1KG 1 kg
EUR 61

Zinc sulfate heptahydrate

GK7296-250G 250 g
EUR 43

Zinc sulfate heptahydrate

GK7296-500G 500 g
EUR 50

Zinc sulfate heptahydrate

GK7296-5KG 5 kg
EUR 134

Zinc Assay Kit

Z5030036 250 assays
EUR 1087
Description: Premade ready to use kits will always come in handy. Get your experiment done right form the first try by using a validated kit with perfectly balanced reagents proportions and compatibility and by following a clear protocol.

Zinc Formalin Solution

ZFN500 500 ml
EUR 84

Zinc Formalin Solution

ZFN999 1000 ml
EUR 106

Zinc acetate dihydrate

ZB1002 250g
EUR 63.92
  • Product category: Biochemicals/Misc. Biochemicals

Zinc nitrate, hexahydrate

ZB1004 500g
EUR 96.98
  • Product category: Biochemicals/Misc. Biochemicals

Zinc sulfate, heptahydrate

ZB2906 500g
EUR 63.92
  • Product category: Biochemicals/Misc. Biochemicals

Zinc, RNA Aptamer, unlabeled

AR-285-U Custom Ask for price

QuantiChrom Zinc Assay Kit

DIZN-250 250
EUR 491
Description: Quantitative determination of zinc ion Zn2+ by colorimetric (425nm) method. Procedure: 30 min. Kit size: 250 tests. Detection limit: 0.78 µg/dL (0.12 µM). Shelf life: 6 months. Shipping: ambient temp; storage: 4, -20°C.

Zinc alpha 2 Glycoprotein

20-abx263089
  • EUR 230.00
  • EUR 1121.00
  • EUR 328.00
  • 1 µg
  • 50 ug
  • 5 ug
  • Shipped within 5-10 working days.

Zinc alpha 2 GlycoProtein

20-abx263091
  • EUR 1121.00
  • EUR 328.00
  • EUR 230.00
  • 100 ug
  • 10 ug
  • 2 µg
  • Shipped within 5-10 working days.

Cephalosporin C zinc salt

HY-B1299A 50mg
EUR 257

Zinc Assay Kit (Fluorometric)

K428-100
EUR 523

Zinc Colorimetric Assay Kit

K387-100
EUR 490

Zinc Chloride Solution (10%)

ZCS500 500 ml
EUR 109

Zinc Chloride Solution (10%)

ZCS999 1000 ml
EUR 156

zinc finger protein 574 antibody

22528-100ul 100ul
EUR 390

zinc finger protein 140 antibody

23079-100ul 100ul
EUR 390

Rat Zinc transporter ZIP13 (Slc39a13)

1-CSB-EP644804RA
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 41.2 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rat Zinc transporter ZIP13(Slc39a13),partial expressed in E.coli

Human Zinc transporter ZIP1 (SLC39A1)

1-CSB-RP179544h
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 9.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Zinc transporter ZIP1(SLC39A1),partial expressed in E.coli

Rat Zinc protoporphyrin ELISA kit

E02Z0039-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Zinc protoporphyrin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Zinc protoporphyrin ELISA kit

E02Z0039-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Zinc protoporphyrin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Zinc protoporphyrin ELISA kit

E02Z0039-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Zinc protoporphyrin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Zinc protoporphyrin ELISA kit

E04Z0039-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Zinc protoporphyrin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Zinc protoporphyrin ELISA kit

E04Z0039-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Zinc protoporphyrin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Zinc protoporphyrin ELISA kit

E04Z0039-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Zinc protoporphyrin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Zinc protoporphyrin ELISA kit

E03Z0039-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Zinc protoporphyrin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Zinc protoporphyrin ELISA kit

E03Z0039-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Zinc protoporphyrin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Zinc protoporphyrin ELISA kit

E03Z0039-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Zinc protoporphyrin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Zinc protoporphyrin ELISA kit

E01Z0039-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Zinc protoporphyrin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Zinc protoporphyrin ELISA kit

E01Z0039-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Zinc protoporphyrin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Zinc protoporphyrin ELISA kit

E01Z0039-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Zinc protoporphyrin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Zinc Transporter ZIP9 (ZIP9) Antibody

20-abx008112
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Zinc Transporter ZIP7 (ZIP7) Antibody

20-abx008550
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Zinc Transporter 1 (SLC30A1) Antibody

20-abx015018
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Zinc Transporter 8 (SLC30A8) Antibody

abx218626-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Zinc Transporter ZIP10 (SLC39A10) Antibody

20-abx218627
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Zinc Transporter ZIP2 (ZIP2) Antibody

abx218628-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

ZPR1 Zinc Finger (ZPR1) Antibody

20-abx212822
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

ZPR1 Zinc Finger (ZPR1) Antibody

20-abx213279
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Zinc transporter ZIP13 Antibody (Biotin)

20-abx106412
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Zinc transporter ZIP13 Antibody (FITC)

20-abx107824
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Zinc Transporter ZIP13 (Slc39a13) Antibody

20-abx110678
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Zinc Transporter 3 (SLC30A3) Antibody

20-abx115691
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Zinc Transporter 8 (SLC30A8) Antibody

20-abx115694
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Zinc Transporter ZIP4 (SLC39A4) Antibody

20-abx115702
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

ZPR1 Zinc Finger (ZPR1) Antibody

20-abx116729
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Zinc Transporter 8 (SLC30A8) Antibody

20-abx123724
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Zinc Transporter 1 (SLC30A1) Antibody

20-abx133538
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Zinc Transporter 1 (SLC30A1) Antibody

20-abx135874
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Zinc transporter ZIP13 Antibody (HRP)

20-abx109241
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Zinc Transporter ZIP8 (S39A8) Antibody

abx034339-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Zinc Transporter ZIP8 (S39A8) Antibody

abx034339-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

JAZF zinc finger 1 Protein

20-abx261055
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Zinc Finger Protein 514 Protein

20-abx261125
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Zinc Finger Protein 346 Protein

20-abx261160
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Zinc Finger Protein 689 Protein

20-abx261185
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Zinc Finger Protein 32 Protein

20-abx261327
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Zinc-alpha-2-glycoprotein Antibody

abx239639-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Zinc Transporter ZIP4 (ZIP4) Antibody

abx239641-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Zinc Transporter ZIP7 (ZIP7) Antibody

abx239642-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Zinc Transporter ZIP8 (ZIP8) Antibody

abx239643-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Zinc Transporter 3 (ZnT3) Antibody

abx239747-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Zinc Transporter 5 (Znt5) Antibody

abx239748-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Zinc Transporter 7 (ZnT7) Antibody

abx239749-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Dog Zinc protoporphyrin ELISA kit

E08Z0039-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Zinc protoporphyrin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Zinc protoporphyrin ELISA kit

E08Z0039-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Zinc protoporphyrin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Zinc protoporphyrin ELISA kit

E08Z0039-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Zinc protoporphyrin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.