Mechanical Forces for in vitro Endothelial Cell Biology

biologiayctma

A Information to Extract Spinal Twine for Translational Stem Cell Biology Analysis: Comparative Evaluation of Grownup Human, Porcine, and Rodent Spinal Twine Stem Cells

Bettering the scientific translation of animal-based neural stem/progenitor cell (NSPC) therapies to people requires an understanding of intrinsic human and animal cell traits. We report a novel in vitro methodology to evaluate spinal wire NSPCs from a small (rodent) and enormous (porcine) animal mannequin compared to human NSPCs.

 To extract reside grownup human, porcine, and rodent spinal wire tissue, we illustrate a method utilizing an anterior or posterior strategy that was simulated in a porcine mannequin.

The preliminary enlargement of major NSPCs is carried out utilizing the neurosphere assay adopted by a pharmacological therapy section throughout which NSPCs derived from people, porcines, and rodents are assessed in parallel utilizing the identical outlined parameters.

 Utilizing this mannequin, NSPCs from all species demonstrated multi-lineage differentiation and self-renewal. Importantly, these strategies present situations to allow the direct comparability of species-dependent cell conduct in response to particular exogenous alerts. 

The Significance of Mechanical Forces for in vitro Endothelial Cell Biology

Blood and lymphatic vessels are lined by endothelial cells which consistently work together with their luminal and abluminal extracellular environments. These interactions confer bodily forces on the endothelium, comparable to shear stress, stretch and stiffness, to mediate organic responses. 

  • These bodily forces are sometimes altered throughout illness, driving irregular endothelial cell conduct and pathology. Due to this fact, it’s important that we perceive the mechanisms by which endothelial cells reply to bodily forces.
  • Historically, endothelial cells in tradition are grown within the absence of circulation on stiff substrates comparable to plastic or glass.
  • These cells usually are not subjected to the bodily forces that endothelial cells endure in vivo, thus the outcomes of those experiments usually don’t mimic these noticed within the physique.
  • The sector of vascular biology now understand that an intricate evaluation of endothelial signaling mechanisms requires complicated in vitro techniques to imitate in vivo situations.
  • Right here, we’ll evaluate what is understood in regards to the mechanical forces that information endothelial cell conduct after which talk about the developments in endothelial cell tradition fashions designed to higher mimic the in vivo vascular microenvironment.
  • A wider software of those applied sciences will present extra biologically related data from cultured cells which will probably be reproducible to situations discovered within the physique.
biologiayctma
biologiayctma

PRKCA Antibody

1-CSB-PA898666
  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PRKCA. Recognizes PRKCA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:200-1:1000, IHC:1:25-1:100

PRKCA Antibody

1-CSB-PA937356
  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PRKCA. Recognizes PRKCA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

PRKCA Antibody

CSB-PA557375-
EUR 335.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline , pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antigen Affinity Purified
Description: A polyclonal antibody against PRKCA. Recognizes PRKCA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

PRKCA Antibody

CSB-PA557375-100ul 100ul
EUR 314.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline , pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antigen Affinity Purified
Description: A polyclonal antibody against PRKCA. Recognizes PRKCA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

PRKCA Antibody

1-CSB-PA566617
  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PRKCA. Recognizes PRKCA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:200-1:1000, IHC:1:25-1:100

PRKCA Antibody

1-CSB-PA15859A0Rb
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PRKCA. Recognizes PRKCA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

PRKCA Antibody

1-CSB-PA105506
  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PRKCA. Recognizes PRKCA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

PRKCA Antibody

CSB-PA018699KA01HU-
EUR 335.00
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against PRKCA. Recognizes PRKCA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

PRKCA Antibody

CSB-PA018699KA01HU-100ul 100ul
EUR 389.00
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against PRKCA. Recognizes PRKCA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

PRKCA Antibody

1-CSB-PA030237
  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against PRKCA. Recognizes PRKCA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/5000

PRKCA Antibody

1-CSB-PA030238
  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against PRKCA. Recognizes PRKCA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/5000

PRKCA Antibody

1-CSB-PA030239
  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against PRKCA. Recognizes PRKCA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/10000

PRKCA Conjugated Antibody

C32053 100ul
EUR 397.00

Mouse Prkca Antibody

abx027933-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

Mouse Prkca Antibody

abx027933-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

PRKCA (pT497) Antibody

abx217939-100ug 100 ug
EUR 439.00
  • Shipped within 5-10 working days.

PRKCA (pS657) Antibody

abx217940-100ug 100 ug
EUR 439.00
  • Shipped within 5-10 working days.

PRKCA (pY658) Antibody

abx333503-100ul 100 ul
EUR 467.00
  • Shipped within 5-10 working days.

Anti-PRKCA antibody

STJ25125 100 µl
EUR 277.00
Description: Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. This kinase has been reported to play roles in many different cellular processes, such as cell adhesion, cell transformation, cell cycle checkpoint, and cell volume control. Knockout studies in mice suggest that this kinase may be a fundamental regulator of cardiac contractility and Ca(2+) handling in myocytes.

Anti-PRKCA antibody

STJ112958 100 µl
EUR 457.00
Description: Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. This kinase has been reported to play roles in many different cellular processes, such as cell adhesion, cell transformation, cell cycle checkpoint, and cell volume control. Knockout studies in mice suggest that this kinase may be a fundamental regulator of cardiac contractility and Ca(2+) handling in myocytes.

Anti-PRKCA antibody

STJ115305 100 µl
EUR 277.00
Description: Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. This kinase has been reported to play roles in many different cellular processes, such as cell adhesion, cell transformation, cell cycle checkpoint, and cell volume control. Knockout studies in mice suggest that this kinase may be a fundamental regulator of cardiac contractility and Ca(2+) handling in myocytes.

Prkca/ Rat Prkca ELISA Kit

ELI-04515r 96 Tests
EUR 886.00

PRKCA siRNA

20-abx929759
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

PRKCA siRNA

20-abx929760
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Phospho-PRKCA (Thr497) Antibody

AF8395 200ul
EUR 376.00
Description: PRKCA (Phospho-Thr497) Antibody detects endogenous levels of PRKCA only when phosphorylated at Thr497.

Phospho-PRKCA (Ser657) Antibody

AF8396 200ul
EUR 376.00
Description: PRKCA (Phospho-Ser657) Antibody detects endogenous levels of PRKCA only when phosphorylated at Ser657.

Phospho-PRKCA (Tyr195) Antibody

AF7240 200ul
EUR 376.00
Description: Phospho-PRKCA (Tyr195) Antibody detects endogenous levels of PRKCA only when phosphorylated at Tyr195.

PRKCA (Phospho- Thr497) Antibody

ABF8395 100 ug
EUR 438.00

PRKCA (Phospho- Ser657) Antibody

ABF8396 100 ug
EUR 438.00

PRKCA (Phospho-Tyr195) Antibody

13096-100ul 100ul
EUR 252.00

PRKCA (Phospho-Tyr195) Antibody

13096-50ul 50ul
EUR 187.00

PRKCA (Ab-657) Antibody

CSB-PA589165-
EUR 335.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against PRKCA (Ab-657). Recognizes PRKCA (Ab-657) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

PRKCA (Ab-657) Antibody

CSB-PA589165-100ul 100ul
EUR 316.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against PRKCA (Ab-657). Recognizes PRKCA (Ab-657) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

PRKCA Antibody, HRP conjugated

1-CSB-PA15859B0Rb
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PRKCA. Recognizes PRKCA from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PRKCA Antibody, FITC conjugated

1-CSB-PA15859C0Rb
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PRKCA. Recognizes PRKCA from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PRKCA Antibody, Biotin conjugated

1-CSB-PA15859D0Rb
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PRKCA. Recognizes PRKCA from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Phospho-PRKCA (Tyr658) Antibody

CSB-PA060190-
EUR 335.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
  • Show more
Description: A polyclonal antibody against Phospho-PRKCA (Tyr658). Recognizes Phospho-PRKCA (Tyr658) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

Phospho-PRKCA (Tyr658) Antibody

CSB-PA060190-100ul 100ul
EUR 362.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
  • Show more
Description: A polyclonal antibody against Phospho-PRKCA (Tyr658). Recognizes Phospho-PRKCA (Tyr658) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

Phospho-PRKCA (Y657) Antibody

1-CSB-PA030235
  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-PRKCA (Y657). Recognizes Phospho-PRKCA (Y657) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

Phospho-PRKCA (T638) Antibody

1-CSB-PA030236
  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-PRKCA (T638). Recognizes Phospho-PRKCA (T638) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000

PRKCA Blocking Peptide

AF7740-BP 1mg
EUR 195.00

PRKCA cloning plasmid

CSB-CL018699HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2019
  • Sequence: ATGGCTGACGTTTTCCCGGGCAACGACTCCACGGCGTCTCAGGACGTGGCCAACCGCTTCGCCCGCAAAGGGGCGCTGAGGCAGAAGAACGTGCACGAGGTGAAGGACCACAAATTCATCGCGCGCTTCTTCAAGCAGCCCACCTTCTGCAGCCACTGCACCGACTTCATCTGGG
  • Show more
Description: A cloning plasmid for the PRKCA gene.

PRKCA Rabbit pAb

A0267-100ul 100 ul
EUR 308.00

PRKCA Rabbit pAb

A0267-200ul 200 ul
EUR 459.00

PRKCA Rabbit pAb

A0267-20ul 20 ul
EUR 183.00

PRKCA Rabbit pAb

A0267-50ul 50 ul
EUR 223.00

PRKCA Rabbit mAb

A11107-100ul 100 ul
EUR 459.00

PRKCA Rabbit mAb

A11107-200ul 200 ul
EUR 686.00

PRKCA Rabbit mAb

A11107-20ul 20 ul Ask for price

PRKCA Rabbit mAb

A11107-50ul 50 ul
EUR 308.00

PRKCA Rabbit pAb

A13342-100ul 100 ul
EUR 308.00

PRKCA Rabbit pAb

A13342-200ul 200 ul
EUR 459.00

PRKCA Rabbit pAb

A13342-20ul 20 ul
EUR 183.00

PRKCA Rabbit pAb

A13342-50ul 50 ul
EUR 223.00

PRKCA Blocking Peptide

DF6070-BP 1mg
EUR 195.00

Recombinant Human PRKCA

P0211 100ug
EUR 522.36
  • Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose
  • Reconstitution: Sterile distilled water
  • Purity: Greater than 95% by SDS-PAGE gel analyses
  • Uniprot ID: P17252
Description: Recombinant Human protein for PRKCA

PRKCA (Phospho-Tyr195) Conjugated Antibody

C13096 100ul
EUR 397.00

Anti-PKC alpha/PRKCA Antibody

PB9318 100ug/vial
EUR 334.00

Anti-PKC alpha/PRKCA Antibody

PA1065 100ug/vial
EUR 334.00

Anti-Phospho-PRKCA-(S226) antibody

STJ113497 100 µl
EUR 393.00
Description: Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. This kinase has been reported to play roles in many different cellular processes, such as cell adhesion, cell transformation, cell cycle checkpoint, and cell volume control. Knockout studies in mice suggest that this kinase may be a fundamental regulator of cardiac contractility and Ca(2+) handling in myocytes.

Anti-Phospho-PRKCA-(S319) antibody

STJ117877 100 µl
EUR 393.00
Description: Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. This kinase has been reported to play roles in many different cellular processes, such as cell adhesion, cell transformation, cell cycle checkpoint, and cell volume control. Knockout studies in mice suggest that this kinase may be a fundamental regulator of cardiac contractility and Ca(2+) handling in myocytes.

Polyclonal Mouse Prkca Antibody (N-term)

APR03938G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Mouse Prkca (N-term). This antibody is tested and proven to work in the following applications:

Protein Kinase C Alpha (PRKCA) Antibody

20-abx125382
  • EUR 592.00
  • EUR 857.00
  • EUR 411.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

Protein Interacting With Prkca 1 Antibody

20-abx114793
  • EUR 732.00
  • EUR 398.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Protein Kinase C Alpha (PRKCA) Antibody

abx116998-100ug 100 ug
EUR 467.00
  • Shipped within 5-10 working days.

Protein Kinase C Alpha (PRKCA) Antibody

20-abx000652
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

Protein Kinase C Alpha (PRKCA) Antibody

abx037155-100ug 100 ug
EUR 391.00
  • Shipped within 5-10 working days.

Protein Kinase C Alpha (PRKCA) Antibody

abx034005-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

Protein Kinase C Alpha (PRKCA) Antibody

abx034005-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

Protein kinase C alpha (PRKCA) Antibody

20-abx326423
  • EUR 314.00
  • EUR 244.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Protein kinase C alpha (PRKCA) Antibody

20-abx327945
  • EUR 314.00
  • EUR 244.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Protein kinase C alpha (PRKCA) Antibody

20-abx329052
  • EUR 314.00
  • EUR 244.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Protein kinase C alpha (PRKCA) Antibody

abx332239-100ul 100 ul
EUR 425.00
  • Shipped within 5-10 working days.

Protein kinase C alpha (PRKCA) Antibody

abx332517-100ul 100 ul
EUR 425.00
  • Shipped within 5-10 working days.

Protein kinase C alpha (PRKCA) Antibody

20-abx241740
  • EUR 411.00
  • EUR 300.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Protein kinase C alpha (PRKCA) Antibody

20-abx241741
  • EUR 411.00
  • EUR 300.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Protein kinase C alpha (PRKCA) Antibody

20-abx241990
  • EUR 411.00
  • EUR 300.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Protein kinase C alpha (PRKCA) Antibody

20-abx242373
  • EUR 411.00
  • EUR 300.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Protein Kinase C Alpha (PRKCA) Antibody

20-abx302139
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Anti-Phospho-PRKCA-S657/Y658 antibody

STJ11101090 100 µl
EUR 393.00
Description: Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. This kinase has been reported to play roles in many different cellular processes, such as cell adhesion, cell transformation, cell cycle checkpoint, and cell volume control. Knockout studies in mice suggest that this kinase may be a fundamental regulator of cardiac contractility and Ca(2+) handling in myocytes.

Anti-Phospho-PRKCA/PRKCB-(T641) antibody

STJ22341 100 µl
EUR 393.00
Description: Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. This protein kinase has been reported to be involved in many different cellular functions, such as B cell activation, apoptosis induction, endothelial cell proliferation, and intestinal sugar absorption. Studies in mice also suggest that this kinase may also regulate neuronal functions and correlate fear-induced conflict behavior after stress. Alternatively spliced transcript variants encoding distinct isoforms have been reported.

Human PRKCA ELISA Kit

ELA-E1380h 96 Tests
EUR 824.00

PRKCA ELISA KIT|Human

EF005341 96 Tests
EUR 689.00

Human PRKCA shRNA Plasmid

20-abx953748
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Mouse PRKCA shRNA Plasmid

20-abx972057
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

PRKCA Recombinant Protein (Human)

RP084903 100 ug Ask for price

PRKCA Recombinant Protein (Rat)

RP222059 100 ug Ask for price

PRKCA Recombinant Protein (Mouse)

RP164438 100 ug Ask for price

Polyclonal PRKCA / PKC-Alpha Antibody (aa1-250)

APR03163G 0.05ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PRKCA / PKC-Alpha (aa1-250). This antibody is tested and proven to work in the following applications:

Monoclonal PRKCA Antibody (monoclonal) (M01), Clone: 2F11

AMM03937G 0.1mg
EUR 484.00
Description: A Monoclonal antibody against Human PRKCA (monoclonal) (M01). The antibodies are raised in mouse and are from clone 2F11. This antibody is applicable in WB, IHC and IF, E

Phospho-threonine [T497] PKCalpha (PRKCA) polyclonal antibody

ABP-PAB-11667 100 ug Ask for price
    • Product line: Kinases
    • Brand:

Protein Kinase C Alpha Type (PRKCA) Antibody

20-abx133286
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

Protein Kinase C Alpha Type (PRKCA) Antibody

abx033114-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

Protein Kinase C Alpha Type (PRKCA) Antibody

abx033114-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

Protein Kinase C Alpha Type (PRKCA) Antibody

abx011355-100ug 100 ug
EUR 425.00
  • Shipped within 5-10 working days.

Protein Kinase C Alpha Type (PRKCA) Antibody

20-abx011394
  • EUR 439.00
  • EUR 258.00
  • EUR 77.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

Protein Kinase C Alpha Type (PRKCA) Antibody

20-abx012800
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

Protein Kinase C Alpha (PRKCA) Antibody (HRP)

20-abx314446
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Protein Kinase C Alpha (PRKCA) Antibody (FITC)

20-abx314447
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Protein Kinase C Alpha (PRKCA) Antibody (Biotin)

20-abx314448
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Rabbit Anti-PRKCA monoclonal antibody, clone KG1075

DCABH-6947 100 ul
EUR 777.00

Phospho-PRKCA (Thr497) Blocking Peptide

AF8395-BP 1mg
EUR 195.00

Phospho-PRKCA (Ser657) Blocking Peptide

AF8396-BP 1mg
EUR 195.00

Phospho-PRKCA (Tyr195) Blocking Peptide

AF7240-BP 1mg
EUR 195.00

Human PRKCA-binding protein (PICK1)

1-CSB-RP054454h
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • MW: 48.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human PRKCA-binding protein(PICK1),partial expressed in E.coli

PRKCA ORF Vector (Human) (pORF)

ORF028302 1.0 ug DNA
EUR 405.00

h PRKCA inducible lentiviral particles

LVP219 1x107 IFU/ml x 200ul
EUR 451.00
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, PRKCA, is fully sequence verified and matched to NCBI accession ID: NM_002737

Prkca ORF Vector (Rat) (pORF)

ORF074021 1.0 ug DNA
EUR 506.00

Prkca ORF Vector (Mouse) (pORF)

ORF054814 1.0 ug DNA
EUR 506.00

PRKCA/PRKCB/PRKCD/PRKCE/PRKCH/PRKCQ Polyclonal Antibody

30229-100ul 100ul
EUR 252.00

PRKCA/PRKCB/PRKCD/PRKCE/PRKCH/PRKCQ Polyclonal Antibody

30229-50ul 50ul
EUR 187.00

Anti-PRKCA/PRKCB/PRKCD/PRKCE/PRKCH/PRKCQ antibody

STJ119908 100 µl
EUR 277.00

Phospho-PRKCA-S657/Y658 Rabbit pAb

AP0970-100ul 100 ul
EUR 384.00

Phospho-PRKCA-S657/Y658 Rabbit pAb

AP0970-200ul 200 ul
EUR 554.00

Phospho-PRKCA-S657/Y658 Rabbit pAb

AP0970-20ul 20 ul
EUR 183.00

Phospho-PRKCA-S657/Y658 Rabbit pAb

AP0970-50ul 50 ul
EUR 265.00

PRKCA sgRNA CRISPR Lentivector set (Human)

K0003901 3 x 1.0 ug
EUR 339.00

PRKCA sgRNA CRISPR Lentivector set (Human)

K1721501 3 x 1.0 ug
EUR 339.00

Prkca sgRNA CRISPR Lentivector set (Mouse)

K4855101 3 x 1.0 ug
EUR 339.00

Prkca sgRNA CRISPR Lentivector set (Rat)

K6807301 3 x 1.0 ug
EUR 339.00

PRKCA/PRKCB/PRKCD/PRKCE/PRKCH/PRKCQ Polyclonal Conjugated Antibody

C30229 100ul
EUR 397.00

Protein kinase C alpha Phospho-Tyr657 (PRKCA pY657) Antibody

20-abx327107
  • EUR 314.00
  • EUR 244.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Protein kinase C alpha Phospho-Thr638 (PRKCA pT638) Antibody

20-abx328538
  • EUR 314.00
  • EUR 244.00
  • 0
  • 1
  • Shipped within 5-10 working days.

PRKCA / PRKCB / PRKCD / PRKCE / PRKCG / PRKCH / PRKCQ / PRKCZ Antibody

20-abx329612
  • EUR 314.00
  • EUR 244.00
  • 0
  • 1
  • Shipped within 5-10 working days.

PRKCA/PRKCB/PRKCD/PRKCE/PRKCG/PRKCH/PRKCQ/PRKCZ Antibody

1-CSB-PA003800
  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against PRKCA/PRKCB/PRKCD/PRKCE/PRKCG/PRKCH/PRKCQ/PRKCZ. Recognizes PRKCA/PRKCB/PRKCD/PRKCE/PRKCG/PRKCH/PRKCQ/PRKCZ from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000

Human PRKCA- binding protein, PICK1 ELISA KIT

ELI-22002h 96 Tests
EUR 824.00

PRKCA sgRNA CRISPR Lentivector (Human) (Target 1)

K0003902 1.0 ug DNA
EUR 154.00

PRKCA sgRNA CRISPR Lentivector (Human) (Target 2)

K0003903 1.0 ug DNA
EUR 154.00

PRKCA sgRNA CRISPR Lentivector (Human) (Target 3)

K0003904 1.0 ug DNA
EUR 154.00

Bovine PRKCA- binding protein, PICK1 ELISA KIT

ELI-35710b 96 Tests
EUR 928.00

Mouse PRKCA- binding protein, Pick1 ELISA KIT

ELI-38036m 96 Tests
EUR 865.00

PRKCA sgRNA CRISPR Lentivector (Human) (Target 1)

K1721502 1.0 ug DNA
EUR 154.00

PRKCA sgRNA CRISPR Lentivector (Human) (Target 2)

K1721503 1.0 ug DNA
EUR 154.00

PRKCA sgRNA CRISPR Lentivector (Human) (Target 3)

K1721504 1.0 ug DNA
EUR 154.00

Prkca sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4855102 1.0 ug DNA
EUR 154.00

Prkca sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4855103 1.0 ug DNA
EUR 154.00

Prkca sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4855104 1.0 ug DNA
EUR 154.00

Prkca sgRNA CRISPR Lentivector (Rat) (Target 1)

K6807302 1.0 ug DNA
EUR 154.00

Prkca sgRNA CRISPR Lentivector (Rat) (Target 2)

K6807303 1.0 ug DNA
EUR 154.00

Prkca sgRNA CRISPR Lentivector (Rat) (Target 3)

K6807304 1.0 ug DNA
EUR 154.00

PRKCA Protein Vector (Human) (pPB-C-His)

PV113206 500 ng
EUR 811.00

PRKCA Protein Vector (Human) (pPB-N-His)

PV113207 500 ng
EUR 811.00

PRKCA Protein Vector (Human) (pPM-C-HA)

PV113208 500 ng
EUR 811.00

PRKCA Protein Vector (Human) (pPM-C-His)

PV113209 500 ng
EUR 811.00

PRKCA Protein Vector (Mouse) (pPB-C-His)

PV219254 500 ng
EUR 1065.00

PRKCA Protein Vector (Mouse) (pPB-N-His)

PV219255 500 ng
EUR 1065.00

PRKCA Protein Vector (Mouse) (pPM-C-HA)

PV219256 500 ng
EUR 1065.00

PRKCA Protein Vector (Mouse) (pPM-C-His)

PV219257 500 ng
EUR 1065.00

PRKCA Protein Vector (Rat) (pPB-C-His)

PV296082 500 ng
EUR 603.00

PRKCA Protein Vector (Rat) (pPB-N-His)

PV296083 500 ng
EUR 603.00

Lengthy-read sequencing to know genome biology and cell operate

Figuring out the sequence of DNA and RNA molecules has a big impact on the understanding of cell biology and performance. Latest developments in next-generation short-read sequencing (NGS) applied sciences, drops in value and a decision all the way down to the single-cell degree formed our present view on genome construction and performance. 

Third-generation sequencing (TGS) strategies additional full the data about these processes primarily based on lengthy reads and the flexibility to investigate DNA or RNA at single molecule degree. 

Lengthy-read sequencing offers further prospects to review genome structure and the composition of extremely complicated areas and to find out epigenetic modifications of nucleotide bases at a genome-wide degree. We talk about the ideas and developments of long-read sequencing and its functions in genome biology.

Plant Cell Wall Proteomes: Bioinformatics and Cell Biology Instruments to Assess the Bona Fide Cell Wall Localization of Proteins

The purification of plant cell partitions is difficult as a result of they represent an open compartment which isn’t restricted by a membrane just like the cell organelles. Completely different methods have been established to restrict the contamination by proteins of different compartments in cell wall proteomics research. 

Non-destructive strategies depend on washing intact cells with varied sorts of options with out disrupting the plasma membrane so as to elute cell wall proteins. In distinction, harmful protocols contain the purification of cell partitions previous to the extraction of proteins with salt options.

 In each instances, proteins identified to be intracellular have been recognized by mass spectrometry in cell wall proteomes. The intention of this chapter is to supply instruments to evaluate the subcellular localization of the proteins recognized in cell wall proteomics research, together with:

(1) bioinformatic predictions,

(2) immunocytolocalization of proteins of curiosity on tissue sections and

(3) in muro remark of proteins of curiosity fused to reporter fluorescent proteins by confocal microscopy.

Lastly, a qualitative evaluation of the work may be carried out and the technique used to organize the samples may be optimized if obligatory.  

Zinc Pyrithione

B2201-5.1 10 mM (in 1mL DMSO)
EUR 119.00
Description: Zinc pyrithione is an antifungal and antibacterial agent disrupting membrane transport by blocking the proton pump.

Zinc Pyrithione

B2201-50 50 mg
EUR 128.00
Description: Zinc pyrithione is an antifungal and antibacterial agent disrupting membrane transport by blocking the proton pump.

Zinc Pyrithione

B2201-S Evaluation Sample
EUR 81.00
Description: Zinc pyrithione is an antifungal and antibacterial agent disrupting membrane transport by blocking the proton pump.

Zinc Protoporphyrin

HY-101193 50mg
EUR 360.00

Bacitracin (Zinc)

HY-B0278 100mg
EUR 156.00

Zinc Pyrithione

HY-B0572 500mg
EUR 108.00

Zinc trifluoromethanesulfonate

20-abx184484
  • EUR 439.00
  • EUR 258.00
  • 0
  • 1
  • Shipped within 1-2 weeks.

Pyrithione zinc

P066-100G 100 g
EUR 218.00

Pyrithione zinc

P066-10G 10 g
EUR 70.00

Zinc chloride

ZB1003 250g
EUR 69.87
  • Product category: Biochemicals/Misc. Biochemicals

Zinc protoporphyrin IX

B6431-10 10 mg
EUR 189.00

Zinc protoporphyrin IX

B6431-5.1 10 mM (in 1mL DMSO)
EUR 189.00

Zinc protoporphyrin IX

B6431-50 50 mg
EUR 635.00

Zinc acetate dihydrate

GX0226-1KG 1 kg
EUR 86.00

Zinc acetate dihydrate

GX0226-250G 250 g
EUR 54.00

Zinc acetate dihydrate

GX0226-5KG 5 kg
EUR 229.00

Zinc nitrate hexahydrate

GX0843-100G 100 g
EUR 44.00

Zinc nitrate hexahydrate

GX0843-1KG 1 kg
EUR 98.00

Zinc nitrate hexahydrate

GX0843-250G 250 g
EUR 54.00

Zinc nitrate hexahydrate

GX0843-500G 500 g
EUR 70.00

Zinc nitrate hexahydrate

GX0843-5KG 5 kg
EUR 233.00

Zinc sulfate monohydrate

GX1311-1KG 1 kg
EUR 68.00

Zinc sulfate monohydrate

GX1311-5KG 5 kg
EUR 166.00

Zinc cyclohexanebutyrate, AAS

GX1602-1G 1 g
EUR 86.00

Zinc oxide, 99%

GK2332-1KG 1 kg
EUR 52.00

Zinc oxide, 99%

GK2332-5KG 5 kg
EUR 106.00

Zinc carbonate basic

GK2449-1KG 1 kg
EUR 135.00

Zinc formaldehyde sulfoxylate

GK3576-100G 100 g
EUR 86.00

Zinc sulfate heptahydrate

GK7296-100G 100 g
EUR 39.00

Zinc sulfate heptahydrate

GK7296-1KG 1 kg
EUR 61.00

Zinc sulfate heptahydrate

GK7296-250G 250 g
EUR 43.00

Zinc sulfate heptahydrate

GK7296-500G 500 g
EUR 50.00

Zinc sulfate heptahydrate

GK7296-5KG 5 kg
EUR 134.00

Zinc chloride, anhydrous

GK8554-100G 100 g
EUR 39.00

Zinc chloride, anhydrous

GK8554-1KG 1 kg
EUR 62.00

Zinc chloride, anhydrous

GK8554-250G 250 g
EUR 44.00

Zinc chloride, anhydrous

GK8554-500G 500 g
EUR 50.00

Zinc chloride, anhydrous

GK8554-5KG 5 kg
EUR 150.00

Zinc citrate trihydrate

GE2021-100G 100 g
EUR 50.00

Zinc citrate trihydrate

GE2021-1KG 1 kg
EUR 126.00

Zinc citrate trihydrate

GE2021-250G 250 g
EUR 62.00

Zinc citrate trihydrate

GE2021-500G 500 g
EUR 86.00

Bacitracin zinc salt

GA1078-1G 1 g
EUR 62.00

Bacitracin zinc salt

GA1078-5G 5 g
EUR 126.00

Zinc citrate dihydrate

GE1507-1KG 1 kg
EUR 138.00

Zinc Assay Kit

abx298876-100Assays 100 Assays
EUR 582.00
  • Shipped within 5-10 working days.

High Density Zinc

6BCL-QHZn-100 100 ml
EUR 372.00

High Density Zinc

6BCL-QHZn-25 25 ml
EUR 162.00

High Density Zinc

6BCL-QHZn-500 500 ml
EUR 1304.00

Low Density Zinc

6BCL-QLZn-100 100 ml
EUR 372.00

Low Density Zinc

6BCL-QLZn-25 25 ml
EUR 162.00

Low Density Zinc

6BCL-QLZn-500 500 ml
EUR 1304.00

Zinc Assay Kit

55R-1394 100 assays
EUR 673.00
Description: Assay Kit for detection of Zinc in the research laboratory

Zinc Assay Kit

Z5030036 250 assays
EUR 1087.00
Description: Premade ready to use kits will always come in handy. Get your experiment done right form the first try by using a validated kit with perfectly balanced reagents proportions and compatibility and by following a clear protocol.

Zinc acetate dihydrate

ZB1002 250g
EUR 63.92
  • Product category: Biochemicals/Misc. Biochemicals

Zinc nitrate, hexahydrate

ZB1004 500g
EUR 96.98
  • Product category: Biochemicals/Misc. Biochemicals

Zinc sulfate, heptahydrate

ZB2906 500g
EUR 63.92
  • Product category: Biochemicals/Misc. Biochemicals

Zinc Formalin Solution

ZFN500 500 ml
EUR 84.00

Zinc Formalin Solution

ZFN999 1000 ml
EUR 106.00

Zinc, RNA Aptamer, unlabeled

AR-285-U Custom Ask for price

Cephalosporin C zinc salt

HY-B1299A 50mg
EUR 257.00

Zinc alpha 2 Glycoprotein

20-abx263089
  • EUR 230.00
  • EUR 1121.00
  • EUR 328.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

Zinc alpha 2 GlycoProtein

20-abx263091
  • EUR 1121.00
  • EUR 328.00
  • EUR 230.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

Zinc Colorimetric Assay Kit

K387-100
EUR 490.00

Zinc Assay Kit (Fluorometric)

K428-100
EUR 523.00

QuantiChrom Zinc Assay Kit

DIZN-250 250
EUR 491.00
Description: Quantitative determination of zinc ion Zn2+ by colorimetric (425nm) method. Procedure: 30 min. Kit size: 250 tests. Detection limit: 0.78 µg/dL (0.12 µM). Shelf life: 6 months. Shipping: ambient temp; storage: 4, -20°C.

Zinc Chloride Solution (10%)

ZCS500 500 ml
EUR 109.00

Zinc Chloride Solution (10%)

ZCS999 1000 ml
EUR 156.00

Mouse Zinc protoporphyrin ELISA kit

E03Z0039-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Zinc protoporphyrin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Zinc protoporphyrin ELISA kit

E03Z0039-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Zinc protoporphyrin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Zinc protoporphyrin ELISA kit

E03Z0039-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Zinc protoporphyrin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Zinc protoporphyrin ELISA kit

E01Z0039-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Zinc protoporphyrin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Zinc protoporphyrin ELISA kit

E01Z0039-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Zinc protoporphyrin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Zinc protoporphyrin ELISA kit

E01Z0039-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Zinc protoporphyrin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Zinc protoporphyrin ELISA kit

E02Z0039-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Zinc protoporphyrin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Zinc protoporphyrin ELISA kit

E02Z0039-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Zinc protoporphyrin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Zinc protoporphyrin ELISA kit

E02Z0039-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Zinc protoporphyrin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Zinc protoporphyrin ELISA kit

E04Z0039-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Zinc protoporphyrin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Zinc protoporphyrin ELISA kit

E04Z0039-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Zinc protoporphyrin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Zinc protoporphyrin ELISA kit

E04Z0039-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Zinc protoporphyrin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Zinc protoporphyrin ELISA kit

E07Z0039-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Zinc protoporphyrin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Zinc protoporphyrin ELISA kit

E07Z0039-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Zinc protoporphyrin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Zinc protoporphyrin ELISA kit

E07Z0039-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Zinc protoporphyrin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Zinc protoporphyrin ELISA kit

E08Z0039-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Zinc protoporphyrin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Zinc protoporphyrin ELISA kit

E08Z0039-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Zinc protoporphyrin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Zinc protoporphyrin ELISA kit

E08Z0039-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Zinc protoporphyrin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Zinc protoporphyrin ELISA kit

E06Z0039-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Zinc protoporphyrin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Zinc protoporphyrin ELISA kit

E06Z0039-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Zinc protoporphyrin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Zinc protoporphyrin ELISA kit

E06Z0039-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Zinc protoporphyrin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Zinc protoporphyrin ELISA kit

E09Z0039-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Zinc protoporphyrin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Zinc protoporphyrin ELISA kit

E09Z0039-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Zinc protoporphyrin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Zinc protoporphyrin ELISA kit

E09Z0039-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Zinc protoporphyrin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

EDTA zinc (II), disodium salt

EB6666 100g
EUR 64.79
  • Product category: Biochemicals/Misc. Biochemicals

10-Undecenoic acid (zinc salt)

HY-B0914A 100mg
EUR 119.00

EDTA disodium zinc salt hydrate

GX3802-100G 100 g
EUR 54.00

EDTA disodium zinc salt hydrate

GX3802-250G 250 g
EUR 75.00

EDTA disodium zinc salt hydrate

GX3802-25G 25 g
EUR 43.00

EDTA disodium zinc salt hydrate

GX3802-500G 500 g
EUR 110.00

Zinc sulfate monohydrate, USP grade

GX6888-1KG 1 kg
EUR 87.00

Zinc sulfate heptahydrate, EP grade

GK8729-100G 100 g
EUR 43.00

Zinc sulfate heptahydrate, EP grade

GK8729-1KG 1 kg
EUR 74.00

Zinc sulfate heptahydrate, EP grade

GK8729-250G 250 g
EUR 50.00

Zinc sulfate heptahydrate, EP grade

GK8729-500G 500 g
EUR 60.00

Zinc sulfate heptahydrate, EP grade

GK8729-5KG 5 kg
EUR 175.00

Gluconic acid zinc(II) salt

GC6411-100G 100 g
EUR 50.00

Gluconic acid zinc(II) salt

GC6411-1KG 1 kg
EUR 134.00

Gluconic acid zinc(II) salt

GC6411-250G 250 g
EUR 64.00

Gluconic acid zinc(II) salt

GC6411-500G 500 g
EUR 90.00

Zinc Transporter 8 (SLC30A8) Antibody

20-abx123724
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

Zinc Transporter 3 (SLC30A3) Antibody

20-abx115691
  • EUR 732.00
  • EUR 398.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Zinc Transporter 8 (SLC30A8) Antibody

20-abx115694
  • EUR 732.00
  • EUR 398.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Zinc Transporter ZIP4 (SLC39A4) Antibody

20-abx115702
  • EUR 732.00
  • EUR 398.00
  • 0
  • 1
  • Shipped within 5-10 working days.

ZPR1 Zinc Finger (ZPR1) Antibody

20-abx116729
  • EUR 732.00
  • EUR 398.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Zinc transporter ZIP13 Antibody (HRP)

20-abx109241
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Zinc Transporter ZIP13 (Slc39a13) Antibody

20-abx110678
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Zinc Transporter ZIP4 (SLC39A4) Antibody

20-abx002482
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

Zinc Transporter 1 (SLC30A1) Antibody

20-abx133538
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

Zinc Transporter 1 (SLC30A1) Antibody

20-abx135874
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

Zinc transporter ZIP13 Antibody (Biotin)

20-abx106412
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Zinc transporter ZIP13 Antibody (FITC)

20-abx107824
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.