Approaches to know cell biology and virulence of Entamoeba histolytica protozoan

0 Comments
biologiayctma

Understanding the Mechanism of Cell Dying in Gemcitabine Resistant Pancreatic Ductal Adenocarcinoma: A Methods Biology Method

Background: Gemcitabine is the usual chemotherapeutic drug administered in superior Pancreatic Ductal Adenocarcinoma (PDAC). Nevertheless, on account of drug resistance in PDAC sufferers, this remedy has change into much less efficient.

Through the years, scientific trials for the search of discovering novel compounds that can be utilized together with gemcitabine have met little or no success.Goal: To foretell the driving elements behind pancreatic ductal adenocarcinoma, and to know the impact of those elements within the development of the illness and their contribution to cell progress and proliferation. 

Strategies: With the assistance of techniques biology approaches and utilizing gene expression knowledge, which is typically present in abundance, dysregulated components in key signalling pathways had been predicted. Distinguished dysregulated components had been built-in right into a mannequin to simulate and research the impact of gemcitabine-induced hypoxia.

 Outcomes: On this research, a number of transcription elements within the type of key drivers of cancer-related genes had been predicted with the assistance of CARNIVAL, and the impact of gemcitabine-induced hypoxia on the apoptosis pathway was proven to affect the downstream components of two main pathway fashions; EGF/VEGF and TNF signalling pathway. 

Conclusion: It was noticed that EGF/VEGF signalling pathway performed a serious function in inducing drug resistance by means of cell progress, proliferation, and avoiding cell loss of life. Focusing on the key upstream elements of this pathway might probably result in profitable remedy.Key phrases: PDAC; apoptosis; cell loss of life; cell signalling; gemcitabine; hypoxia; techniques biology.  

biologiayctma
biologiayctma

Rabbit Anti Human IgG

E61I00101 100ug
EUR 343.00

Rabbit anti Human IgG

40C-CB0943 1 mg
EUR 249.00
Description: Rabbit anti Human IgG secondary antibody

Rabbit anti Human IgG

40C-CB0950 5 mg
EUR 381.00
Description: Rabbit anti Human IgG secondary antibody

Rabbit anti Human IgG

40C-CB0971 2 mg
EUR 322.00
Description: Rabbit anti Human IgG secondary antibody

Rabbit anti Human IgM

40C-CB9100 2 mg
EUR 283.00
Description: Rabbit anti Human IgM secondary antibody

Rabbit anti Human IgA

40C-CB9114 2 mg
EUR 259.00
Description: Rabbit anti Human IgA secondary antibody

Rabbit anti Human IgE

20-IR77 1 ml
EUR 192.00
Description: Rabbit anti Human IgE antibody

Rabbit anti-Human CD40 antiserum

CD4011-S 100 ul
EUR 457.00

Rabbit Anti-Human IgG FC

C020221-1mg 1mg
EUR 269.00

Rabbit Anti-Human IgG FC

C020221-50mg 50mg
EUR 6015.00

Rabbit Anti-Human Barttin antiserum

BRTN11-S 100 ul
EUR 457.00

Rabbit Anti Human IgG-Biotin

E61I00102 1mg
EUR 499.00

Rabbit Anti Human IgG-HRP

E61I00103 1mg
EUR 499.00

Rabbit Anti Human IgG-FITC

E61I00104 1mg
EUR 611.00

Rabbit Anti-Human Iceberg antiserum

ICEBERG11-S 100 ul
EUR 457.00

Rabbit Anti-Human Endostatin antiserum

ENST11-S 100 ul
EUR 457.00

Rabbit Anti-Human IgM Antibody

20-abx134798
  • EUR 258.00
  • EUR 342.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Rabbit Anti-Human IgA Antibody

abx019263-01ml 0.1 ml
EUR 328.00
  • Shipped within 5-10 working days.

Rabbit anti Human IgG (FITC)

43C-CB0944 1 mg
EUR 311.00
Description: Rabbit anti Human IgG secondary antibody (FITC)

Rabbit anti Human IgG (rhodamine)

43C-CB0945 1 mg
EUR 348.00
Description: Rabbit anti Human IgG secondary antibody (Rhodamine)

Rabbit anti Human IgG (biotin)

43C-CB0947 1 mg
EUR 340.00
Description: Rabbit anti Human IgG secondary antibody (biotin)

Rabbit anti Human IgG (HRP)

43C-CB0948 1 mg
EUR 417.00
Description: Rabbit anti Human IgG secondary antibody (HRP)

Rabbit anti Human IgG (FITC)

43C-CB0951 2 mg
EUR 273.00
Description: Rabbit anti Human IgG secondary antibody (FITC)

Rabbit anti Human IgG (rhodamine)

43C-CB0952 2 mg
EUR 278.00
Description: Rabbit anti Human IgG secondary antibody (Rhodamine)

Rabbit anti Human IgG (biotin)

43C-CB0954 2 mg
EUR 340.00
Description: Rabbit anti Human IgG secondary antibody (biotin)

Rabbit anti Human IgG (HRP)

43C-CB0955 2 mg
EUR 361.00
Description: Rabbit anti Human IgG secondary antibody (HRP)

Rabbit anti Human IgG (FITC)

43C-CB0965 2 mg
EUR 291.00
Description: Rabbit anti Human IgG secondary antibody (FITC)

Rabbit anti Human IgG (rhodamine)

43C-CB0966 2 mg
EUR 291.00
Description: Rabbit anti Human IgG secondary antibody (Rhodamine)

Rabbit anti Human IgG (biotin)

43C-CB0968 2 mg
EUR 359.00
Description: Rabbit anti Human IgG secondary antibody (biotin)

Rabbit anti Human IgG (HRP)

43C-CB0969 2 mg
EUR 369.00
Description: Rabbit anti Human IgG secondary antibody (HRP)

Rabbit anti Human IgM (FITC)

43C-CB9101 1.5 mg
EUR 315.00
Description: Rabbit anti Human IgM secondary antibody (FITC)

Rabbit anti Human IgM (rhodamine)

43C-CB9102 1.5 mg
EUR 302.00
Description: Rabbit anti Human IgM secondary antibody (Rhodamine)

Rabbit anti Human IgM (biotin)

43C-CB9104 1.5 mg
EUR 357.00
Description: Rabbit anti Human IgM secondary antibody (biotin)

Rabbit anti Human IgM (HRP)

43C-CB9105 1.5 mg
EUR 392.00
Description: Rabbit anti Human IgM secondary antibody (HRP)

Rabbit anti Human IgA (FITC)

43C-CB9115 1 mg
EUR 294.00
Description: Rabbit anti Human IgA secondary antibody (FITC)

Rabbit anti Human IgA (rhodamine)

43C-CB9116 1 mg
EUR 301.00
Description: Rabbit anti Human IgA secondary antibody (Rhodamine)

Rabbit anti Human IgA (biotin)

43C-CB9118 1 mg
EUR 361.00
Description: Rabbit anti Human IgA secondary antibody (biotin)

Rabbit anti Human IgA (HRP)

43C-CB9119 1 mg
EUR 368.00
Description: Rabbit anti Human IgA secondary antibody (HRP)

Rabbit Anti-human CYP1B1 antiserum

CYP1B11-S 100 ul
EUR 457.00

pAb rabbit anti-human EPO

CT282 0.5 mg
EUR 184.00

Rabbit Anti-Human Parkin antiserum

PARK11-S 100 ul
EUR 457.00

Rabbit Anti-Human Livin antiserum

LIVN11-S 100 ul
EUR 457.00

Rabbit Anti-Human Sialin antiserum

SIAL11-S 100 ul
EUR 457.00

Anti-CD63 Antibody (rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-CD63A-1 25 ul
EUR 219.00
  • Category: Exosomes

Anti-CD81 Antibody (rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-CD81A-1 25 ul
EUR 219.00
  • Category: Exosomes

Anti-CD9 Antibody (rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-CD9A-1 25 ul
EUR 219.00
  • Category: Exosomes

Anti-Hsp70 Antibody (rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-Hsp70A-1 25 ul
EUR 219.00
  • Category: Exosomes

Rabbit anti Bovine

E61I02501 0.1mg
EUR 343.00

UltraTek Anti-Rabbit

ABK008 8 ml
EUR 80.00

UltraTek Anti-Rabbit

ABK015 15 ml
EUR 98.00

UltraTek Anti-Rabbit

ABK125 125 ml
EUR 228.00

UltraTek Anti-Rabbit

ABK500 500 ml
EUR 554.00

UltraTek Anti-Rabbit

ABK999 1000 ml
EUR 934.00

SensiTek Anti-Rabbit

ABE008 8 ml
EUR 71.00

SensiTek Anti-Rabbit

ABE015 15 ml
EUR 80.00

SensiTek Anti-Rabbit

ABE125 125 ml
EUR 176.00

SensiTek Anti-Rabbit

ABE500 500 ml
EUR 420.00

SensiTek Anti-Rabbit

ABE999 1000 ml
EUR 711.00

Anti-Rabbit antibody

STJ11100323 100 µl
EUR 277.00

Anti-ALIX Antibody (rabbit anti-human, mouse, rat) with goat anti-rabbit HRP secondary antibody

EXOAB-ALIX-1 25 ul
EUR 219.00

Anti-ANXA5 Antibody (rabbit anti-human, mouse, rat) with goat anti-rabbit HRP secondary antibody

EXOAB-ANXA5-1 25 ul
EUR 219.00

Anti-CXCR4 Antibody (rabbit anti-human, mouse, rat) with goat anti-rabbit HRP secondary antibody

EXOAB-CXCR4-1 25 ul
EUR 219.00

Anti-EpCam Antibody (rabbit anti-human, mouse, rat) with goat anti-rabbit HRP secondary antibody

EXOAB-EPCAM1-1 25 ul
EUR 219.00

Anti-FLOT1 Antibody (rabbit anti-human, mouse, rat) with goat anti-rabbit HRP secondary antibody

EXOAB-FLOT1-1 25 ul
EUR 219.00

Anti-TSG101 Antibody (rabbit anti-human, mouse, rat) with goat anti-rabbit HRP secondary antibody

EXOAB-TSG101-1 25 ul
EUR 219.00

Anti-Vimentin Antibody (rabbit anti-human, mouse, rat) with goat anti-rabbit HRP secondary antibody

EXOAB-VMTN-1 25 ul
EUR 219.00

Rabbit Anti-Human Plasma Albumin IgG

ALBH12-A 100 ul
EUR 408.00

Rabbit Anti-Human Amylin antiserum # 2

AMYL12-S 100 ul
EUR 457.00

Rabbit Anti-Human SMAD6 polyclonal antibody

CABT-BL001 100 ul
EUR 585.00

Rabbit Anti-Human GEN1 polyclonal antibody

CABT-BL002 100 ul
EUR 585.00

Rabbit Anti-Human STX8 polyclonal antibody

CABT-BL003 100 ul
EUR 585.00

Rabbit Anti-Human KIR3DL3 polyclonal antibody

CABT-BL004 100 ul
EUR 585.00

Rabbit Anti-Human PCDH15 polyclonal antibody

CABT-BL005 100 ul
EUR 585.00

Rabbit Anti-Human HGFAC polyclonal antibody

CABT-BL006 100 ul
EUR 585.00

Rabbit Anti-Human TXNL4A polyclonal antibody

CABT-BL007 100 ul
EUR 585.00

Rabbit Anti-Human PSMB1 polyclonal antibody

CABT-BL008 100 ul
EUR 585.00

Rabbit Anti-Human MYOC polyclonal antibody

CABT-BL009 100 ul
EUR 585.00

Rabbit Anti-Human IL12RB1 polyclonal antibody

CABT-BL010 100 ul
EUR 585.00

Rabbit Anti-Human TAPBP polyclonal antibody

CABT-BL011 100 ul
EUR 585.00

Rabbit Anti-Human DLGAP5 polyclonal antibody

CABT-BL012 100 ul
EUR 585.00

Rabbit Anti-Human HSPB2 polyclonal antibody

CABT-BL013 100 ul
EUR 585.00

Rabbit Anti-Human TCOF1 polyclonal antibody

CABT-BL016 100 ul
EUR 585.00

Rabbit Anti-Human NEDD9 polyclonal antibody

CABT-BL017 100 ul
EUR 585.00

Rabbit Anti-Human LRPAP1 polyclonal antibody

CABT-BL018 100 ul
EUR 585.00

Rabbit Anti-Human MMP25 polyclonal antibody

CABT-BL019 100 ul
EUR 585.00

Rabbit Anti-Human NTSR1 polyclonal antibody

CABT-BL020 100 ul
EUR 585.00

Rabbit Anti-Human UBC polyclonal antibody

CABT-BL025 100 ul
EUR 585.00

Rabbit Anti-Human LRPPRC polyclonal antibody

CABT-BL026 100 ul
EUR 585.00

Rabbit Anti-Human PTPN23 polyclonal antibody

CABT-BL027 100 ul
EUR 585.00

Rabbit Anti-Human LPCAT1 polyclonal antibody

CABT-BL028 100 ul
EUR 585.00

Rabbit Anti-Human SESN3 polyclonal antibody

CABT-BL029 100 ul
EUR 585.00

Rabbit Anti-Human DDX5 polyclonal antibody

CABT-BL030 100 ul
EUR 585.00

Rabbit Anti-Human POLD1 polyclonal antibody

CABT-BL031 100 ul
EUR 585.00

Rabbit Anti-Human KIF2C polyclonal antibody

CABT-BL032 100 ul
EUR 585.00

Rabbit Anti-Human SKIV2L2 polyclonal antibody

CABT-BL033 100 ul
EUR 585.00

Rabbit Anti-Human HADHB polyclonal antibody

CABT-BL034 100 ul
EUR 585.00

Rabbit Anti-Human DAPK1 polyclonal antibody

CABT-BL035 100 ul
EUR 585.00

Rabbit Anti-Human NFKBIB polyclonal antibody

CABT-BL036 100 ul
EUR 585.00

Rabbit Anti-Human HELLS polyclonal antibody

CABT-BL037 100 ul
EUR 585.00

Rabbit Anti-Human RBM3 polyclonal antibody

CABT-BL038 100 ul
EUR 585.00

Rabbit Anti-Human PRPF4 polyclonal antibody

CABT-BL039 100 ul
EUR 585.00

Rabbit Anti-Human CLPS polyclonal antibody

CABT-BL040 100 ul
EUR 585.00

Rabbit Anti-Human SLC26A2 polyclonal antibody

CABT-BL041 100 ul
EUR 585.00

Rabbit Anti-Human KIF2B polyclonal antibody

CABT-BL042 100 ul
EUR 585.00

Rabbit Anti-Human HPD polyclonal antibody

CABT-BL043 100 ul
EUR 585.00

Rabbit Anti-Human BAMBI polyclonal antibody

CABT-BL044 100 ul
EUR 585.00

Rabbit Anti-Human INTS6 polyclonal antibody

CABT-BL045 100 ul
EUR 585.00

Rabbit Anti-Human NHLRC1 polyclonal antibody

CABT-BL046 100 ul
EUR 585.00

Rabbit Anti-Human HUS1B polyclonal antibody

CABT-BL047 100 ul
EUR 585.00

Rabbit Anti-Human MUS81 polyclonal antibody

CABT-BL048 100 ul
EUR 585.00

Rabbit Anti-Human RDM1 polyclonal antibody

CABT-BL049 100 ul
EUR 585.00

Rabbit Anti-Human ATP2B2 polyclonal antibody

CABT-BL050 100 ul
EUR 585.00

Rabbit Anti-Human DGUOK polyclonal antibody

CABT-BL051 100 ul
EUR 585.00

Rabbit Anti-Human GABPB1 polyclonal antibody

CABT-BL052 100 ul
EUR 585.00

Rabbit Anti-Human KCND3 polyclonal antibody

CABT-BL053 100 ul
EUR 585.00

Rabbit Anti-Human PYCR1 polyclonal antibody

CABT-BL054 100 ul
EUR 585.00

Rabbit Anti-Human GCA polyclonal antibody

CABT-BL055 100 ul
EUR 585.00

Rabbit Anti-Human NSUN6 polyclonal antibody

CABT-BL056 100 ul
EUR 585.00

Rabbit Anti-Human METTL2A polyclonal antibody

CABT-BL058 100 ul
EUR 585.00

Rabbit Anti-Human TRIAP1 polyclonal antibody

CABT-BL059 100 ul
EUR 585.00

Rabbit Anti-Human ARHGAP44 polyclonal antibody

CABT-BL060 100 ul
EUR 585.00

Rabbit Anti-Human KPNA6 polyclonal antibody

CABT-BL061 100 ul
EUR 585.00

Rabbit Anti-Human GSTM4 polyclonal antibody

CABT-BL062 100 ul
EUR 585.00

Rabbit Anti-Human SULT1E1 polyclonal antibody

CABT-BL063 100 ul
EUR 585.00

Rabbit Anti-Human FGFBP1 polyclonal antibody

CABT-BL064 100 ul
EUR 585.00

Rabbit Anti-Human COQ3 polyclonal antibody

CABT-BL065 100 ul
EUR 585.00

Rabbit Anti-Human GSDMB polyclonal antibody

CABT-BL066 100 ul
EUR 585.00

Rabbit Anti-Human PCDHA13 polyclonal antibody

CABT-BL067 100 ul
EUR 585.00

Rabbit Anti-Human RAB31 polyclonal antibody

CABT-BL068 100 ul
EUR 585.00

Rabbit Anti-Human LSM11 polyclonal antibody

CABT-BL069 100 ul
EUR 585.00

Rabbit Anti-Human COX1 polyclonal antibody

CABT-BL070 100 ul
EUR 585.00

Rabbit Anti-Human CYP3A5 polyclonal antibody

CABT-BL071 100 ul
EUR 585.00

Rabbit Anti-Human GSTA2 polyclonal antibody

CABT-BL072 100 ul
EUR 585.00

Rabbit Anti-Human IGSF3 polyclonal antibody

CABT-BL073 100 ul
EUR 585.00

Rabbit Anti-Human PSTPIP1 polyclonal antibody

CABT-BL074 100 ul
EUR 585.00

Rabbit Anti-Human CPLX2 polyclonal antibody

CABT-BL075 100 ul
EUR 585.00

Rabbit Anti-Human CFHR3 polyclonal antibody

CABT-BL076 100 ul
EUR 585.00

Rabbit Anti-Human CD2AP polyclonal antibody

CABT-BL077 100 ul
EUR 585.00

Rabbit Anti-Human GABARAPL1 polyclonal antibody

CABT-BL078 100 ul
EUR 585.00

Rabbit Anti-Human ACAD9 polyclonal antibody

CABT-BL079 100 ul
EUR 585.00

Rabbit Anti-Human SPICE1 polyclonal antibody

CABT-BL080 100 ul
EUR 585.00

Rabbit Anti-Human TMEM184A polyclonal antibody

CABT-BL081 100 ul
EUR 585.00

Rabbit Anti-Human ALDH9A1 polyclonal antibody

CABT-BL082 100 ul
EUR 585.00

Rabbit Anti-Human KCNS3 polyclonal antibody

CABT-BL083 100 ul
EUR 585.00

Rabbit Anti-Human MTX1 polyclonal antibody

CABT-BL084 100 ul
EUR 585.00

Rabbit Anti-Human SSNA1 polyclonal antibody

CABT-BL085 100 ul
EUR 585.00

Rabbit Anti-Human RUFY2 polyclonal antibody

CABT-BL086 100 ul
EUR 585.00

Rabbit Anti-Human USP26 polyclonal antibody

CABT-BL087 100 ul
EUR 585.00

Rabbit Anti-Human TRMT61B polyclonal antibody

CABT-BL088 100 ul
EUR 585.00

Rabbit Anti-Human Gm13125 polyclonal antibody

CABT-BL089 100 ul
EUR 585.00

Rabbit Anti-Human ERCC4 polyclonal antibody

CABT-BL090 100 ul
EUR 585.00

Rabbit Anti-Human MGAT3 polyclonal antibody

CABT-BL091 100 ul
EUR 585.00

Rabbit Anti-Human KANSL3 polyclonal antibody

CABT-BL092 100 ul
EUR 585.00

Rabbit Anti-Human CEP57L1 polyclonal antibody

CABT-BL093 100 ul
EUR 585.00

Rabbit Anti-Human ANKRD28 polyclonal antibody

CABT-BL094 100 ul
EUR 585.00

Rabbit Anti-Human EME1 polyclonal antibody

CABT-BL095 100 ul
EUR 585.00

Rabbit Anti-Human ANKRD52 polyclonal antibody

CABT-BL096 100 ul
EUR 585.00

Rabbit Anti-Human UBE2NL polyclonal antibody

CABT-BL097 100 ul
EUR 585.00

Rabbit Anti-Human GTF2H4 polyclonal antibody

CABT-BL098 100 ul
EUR 585.00

Rabbit Anti-Human HRG polyclonal antibody

CABT-BL099 100 ul
EUR 585.00

Rabbit Anti-Human SLCO1A2 polyclonal antibody

CABT-BL100 100 ul
EUR 585.00

Rabbit Anti-Human FAM20A polyclonal antibody

CABT-BL101 100 ul
EUR 585.00

Rabbit Anti-Human PRDM11 polyclonal antibody

CABT-BL102 100 ul
EUR 585.00

Rabbit Anti-Human POLD4 polyclonal antibody

CABT-BL103 100 ul
EUR 585.00

Rabbit Anti-Human AQP9 polyclonal antibody

CABT-BL104 100 ul
EUR 585.00

Rabbit Anti-Human SLC16A11 polyclonal antibody

CABT-BL105 100 ul
EUR 585.00

Rabbit Anti-Human KCNK9 polyclonal antibody

CABT-BL106 100 ul
EUR 585.00

Rabbit Anti-Human CDY1 polyclonal antibody

CABT-BL107 100 ul
EUR 585.00

Rabbit Anti-Human BAZ1A polyclonal antibody

CABT-BL108 100 ul
EUR 585.00

Rabbit Anti-Human HIST1H2BG polyclonal antibody

CABT-BL109 100 ul
EUR 585.00

Rabbit Anti-Human GLDC polyclonal antibody

CABT-BL110 100 ul
EUR 585.00

Rabbit Anti-Human KIR3DS1 polyclonal antibody

CABT-BL111 100 ul
EUR 585.00

Rabbit Anti-Human TRIP12 polyclonal antibody

CABT-BL112 100 ul
EUR 585.00

Rabbit Anti-Human CLDND1 polyclonal antibody

CABT-BL120 100 ul
EUR 585.00

Rabbit Anti-Human RGN polyclonal antibody

CABT-BL121 100 ul
EUR 585.00

Rabbit Anti-Human UBL3 polyclonal antibody

CABT-BL122 100 ul
EUR 585.00

Rabbit Anti-Human KCNJ5 polyclonal antibody

CABT-BL123 100 ul
EUR 585.00

Rabbit Anti-Human CENPK polyclonal antibody

CABT-BL124 100 ul
EUR 585.00

Rabbit Anti-Human SERPINA12 polyclonal antibody

CABT-BL125 100 ul
EUR 585.00

Rabbit Anti-Human CNTNAP3 polyclonal antibody

CABT-BL126 100 ul
EUR 585.00

Rabbit Anti-Human EBNA1BP2 polyclonal antibody

CABT-BL127 100 ul
EUR 585.00

Rabbit Anti-Human RBM15B polyclonal antibody

CABT-BL128 100 ul
EUR 585.00

Rabbit Anti-Human DET1 polyclonal antibody

CABT-BL129 100 ul
EUR 585.00

Rabbit Anti-Human MZT2B polyclonal antibody

CABT-BL130 100 ul
EUR 585.00

Rabbit Anti-Human DIAPH2 polyclonal antibody

CABT-BL133 100 ul
EUR 585.00

Rabbit Anti-Human EVPL polyclonal antibody

CABT-BL134 100 ul
EUR 585.00

Rabbit Anti-Human XPNPEP2 polyclonal antibody

CABT-BL135 100 ul
EUR 585.00

Rabbit Anti-Human BICD2 polyclonal antibody

CABT-BL136 100 ul
EUR 585.00

Rabbit Anti-Human IL20RA polyclonal antibody

CABT-BL137 100 ul
EUR 585.00

Rabbit Anti-Human GNG2 polyclonal antibody

CABT-BL138 100 ul
EUR 585.00

Rabbit Anti-Human SLC28A3 polyclonal antibody

CABT-BL139 100 ul
EUR 585.00

Rabbit Anti-Human FCRL4 polyclonal antibody

CABT-BL140 100 ul
EUR 585.00

Rabbit Anti-Human L3MBTL2 polyclonal antibody

CABT-BL141 100 ul
EUR 585.00

Rabbit Anti-Human STRIP1 polyclonal antibody

CABT-BL142 100 ul
EUR 585.00

Rabbit Anti-Human SLC4A5 polyclonal antibody

CABT-BL143 100 ul
EUR 585.00

Rabbit Anti-Human JMJD8 polyclonal antibody

CABT-BL144 100 ul
EUR 585.00

Rabbit Anti-Human NOMO1 polyclonal antibody

CABT-BL145 100 ul
EUR 585.00

Rabbit Anti-Human CRP monoclonal antibody

CABT-BL8427 100 ul
EUR 663.00

Rabbit Anti-Human CRP monoclonal antibody

CABT-BL8428 100 ul
EUR 663.00

Rabbit Anti-Human CRP monoclonal antibody

CABT-BL8429 100 ul
EUR 663.00

Proteomics approaches to know cell biology and virulence of Entamoeba histolytica protozoan parasite

  • Entamoeba histolytica is the primitive eukaryotic parasite accountable of human amoebiasis, a illness characterised by bloody intestinal diarrhea and invasive extraintestinal sickness.
  • The data of the full genome sequence of virulent E. histolytica and associated non-pathogenic species allowed the event of novel genome-wide methodological approaches together with protein expression profiling and mobile proteomics within the so referred to as post-genomic period.
  • Proteomics research have vastly elevated our understanding of the cell biology of this historic parasite.
  • This overview summarizes the present works regarding proteomics research on cell biology, life cycle, virulence and pathogenesis, novel therapies, and protein expression regulation mechanisms in E. histolytica parasite.
  • Additionally, we talk about using proteomics knowledge for the event of novel therapies, the identification of potential illness biomarkers and differential prognosis between species.
  • SIGNIFICANCE: Entamoeba histolytica is the unicellular protozoan parasite accountable of human amoebiasis, a critical illness with worldwide distribution characterised by bloody intestinal diarrhea and invasive extraintestinal sickness together with peritonitis and liver, pulmonary and mind abscesses.
  • The post-genomic period allowed the event of proteomic research together with protein expression profiling and mobile proteomics.
  • These proteomics research have vastly elevated our understanding on cell biology, life cycle (cyst-trophozoite conversion), virulence, pathogenesis, novel therapies, and protein expression regulation mechanisms in E. histolytica.
  • Importantly, proteomics has revealed the identification of proteins associated to novel therapies, and the identification of potential illness biomarkers and proteins with use in prognosis between species.
  • Hopefully within the coming years, and thru using extra subtle omics instruments, together with deep proteomics, a extra full set of proteins concerned within the aforementioned mobile processes might be obtained and thus perceive the biology of this historic eukaryote.

Useful Modules of Minimal Cell Division for Artificial Biology

Mobile replica is without doubt one of the basic hallmarks of life. Due to this fact, the event of a minimal division equipment able to correct genome condensation and group, mid-cell positioning and segregation in area and time, and the ultimate septation course of represent a basic challenge for artificial biology. It’s due to this fact vital to have the ability to engineer such modules for the manufacturing of synthetic minimal cells. 

A bottom-up meeting of molecular machines from bulk biochemicals complemented by in vivo experiments in addition to computational modelling helps to method such key mobile processes. Right here, minimal useful modules concerned in genome segregation and the division equipment and their spatial group and positioning are reviewed, setting into perspective the design of a minimal cell. Moreover, the milestones of latest in vitro reconstitution experiments within the context of cell division are mentioned and their function in shedding mild on basic mobile mechanisms that represent spatiotemporal order is described. Lastly, present challenges within the subject of bottom-up artificial biology in addition to potential future developments towards the event of minimal biomimetic techniques are mentioned. 

PRKCA Antibody

1-CSB-PA898666
  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PRKCA. Recognizes PRKCA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:200-1:1000, IHC:1:25-1:100

PRKCA Antibody

DF6070 200ul
EUR 304.00
Description: PRKCA Antibody detects endogenous levels of total PRKCA.

PRKCA Antibody

CSB-PA557375-
EUR 335.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline , pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antigen Affinity Purified
Description: A polyclonal antibody against PRKCA. Recognizes PRKCA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

PRKCA Antibody

CSB-PA557375-100ul 100ul
EUR 314.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline , pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antigen Affinity Purified
Description: A polyclonal antibody against PRKCA. Recognizes PRKCA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

PRKCA Antibody

1-CSB-PA566617
  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PRKCA. Recognizes PRKCA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:200-1:1000, IHC:1:25-1:100

PRKCA Antibody

1-CSB-PA030237
  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against PRKCA. Recognizes PRKCA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/5000

PRKCA Antibody

1-CSB-PA030238
  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against PRKCA. Recognizes PRKCA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/5000

PRKCA Antibody

1-CSB-PA030239
  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against PRKCA. Recognizes PRKCA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/10000

PRKCA Antibody

1-CSB-PA15859A0Rb
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PRKCA. Recognizes PRKCA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

PRKCA antibody

70R-34650 100 ug
EUR 327.00
Description: Purified Rabbit polyclonal PRKCA antibody

PRKCA Antibody

CSB-PA018699KA01HU-
EUR 335.00
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against PRKCA. Recognizes PRKCA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

PRKCA Antibody

CSB-PA018699KA01HU-100ul 100ul
EUR 389.00
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against PRKCA. Recognizes PRKCA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

PRKCA Antibody

AF7740 200ul
EUR 376.00
Description: PRKCA Antibody detects endogenous levels of PRKCA.

PRKCA Antibody

ABD6070 100 ug
EUR 438.00

Mouse Prkca Antibody

abx027933-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

Mouse Prkca Antibody

abx027933-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

PRKCA (pT497) Antibody

abx217939-100ug 100 ug
EUR 439.00
  • Shipped within 5-10 working days.

PRKCA (pS657) Antibody

abx217940-100ug 100 ug
EUR 439.00
  • Shipped within 5-10 working days.

PRKCA Conjugated Antibody

C32053 100ul
EUR 397.00

PRKCA (pY658) Antibody

abx333503-100ul 100 ul
EUR 467.00
  • Shipped within 5-10 working days.

Anti-PRKCA antibody

STJ25125 100 µl
EUR 277.00
Description: Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. This kinase has been reported to play roles in many different cellular processes, such as cell adhesion, cell transformation, cell cycle checkpoint, and cell volume control. Knockout studies in mice suggest that this kinase may be a fundamental regulator of cardiac contractility and Ca(2+) handling in myocytes.

Anti-PRKCA antibody

STJ112958 100 µl
EUR 457.00
Description: Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. This kinase has been reported to play roles in many different cellular processes, such as cell adhesion, cell transformation, cell cycle checkpoint, and cell volume control. Knockout studies in mice suggest that this kinase may be a fundamental regulator of cardiac contractility and Ca(2+) handling in myocytes.

Anti-PRKCA antibody

STJ115305 100 µl
EUR 277.00
Description: Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. This kinase has been reported to play roles in many different cellular processes, such as cell adhesion, cell transformation, cell cycle checkpoint, and cell volume control. Knockout studies in mice suggest that this kinase may be a fundamental regulator of cardiac contractility and Ca(2+) handling in myocytes.

Prkca/ Rat Prkca ELISA Kit

ELI-04515r 96 Tests
EUR 886.00

PRKCA siRNA

20-abx929759
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

PRKCA siRNA

20-abx929760
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

PRKCA (Phospho-Tyr195) Antibody

13096-100ul 100ul
EUR 252.00

PRKCA (Phospho-Tyr195) Antibody

13096-50ul 50ul
EUR 187.00

Phospho-PRKCA (Tyr658) Antibody

CSB-PA060190-
EUR 335.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
  • Show more
Description: A polyclonal antibody against Phospho-PRKCA (Tyr658). Recognizes Phospho-PRKCA (Tyr658) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

Phospho-PRKCA (Tyr658) Antibody

CSB-PA060190-100ul 100ul
EUR 362.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
  • Show more
Description: A polyclonal antibody against Phospho-PRKCA (Tyr658). Recognizes Phospho-PRKCA (Tyr658) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

PRKCA (Ab-657) Antibody

CSB-PA589165-
EUR 335.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against PRKCA (Ab-657). Recognizes PRKCA (Ab-657) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

PRKCA (Ab-657) Antibody

CSB-PA589165-100ul 100ul
EUR 316.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against PRKCA (Ab-657). Recognizes PRKCA (Ab-657) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

Phospho-PRKCA (Y657) Antibody

1-CSB-PA030235
  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-PRKCA (Y657). Recognizes Phospho-PRKCA (Y657) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

Phospho-PRKCA (T638) Antibody

1-CSB-PA030236
  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-PRKCA (T638). Recognizes Phospho-PRKCA (T638) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000

PRKCA Antibody, HRP conjugated

1-CSB-PA15859B0Rb
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PRKCA. Recognizes PRKCA from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PRKCA Antibody, FITC conjugated

1-CSB-PA15859C0Rb
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PRKCA. Recognizes PRKCA from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PRKCA Antibody, Biotin conjugated

1-CSB-PA15859D0Rb
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PRKCA. Recognizes PRKCA from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Phospho-PRKCA (Tyr195) Antibody

AF7240 200ul
EUR 376.00
Description: Phospho-PRKCA (Tyr195) Antibody detects endogenous levels of PRKCA only when phosphorylated at Tyr195.

Phospho-PRKCA (Thr497) Antibody

AF8395 200ul
EUR 376.00
Description: PRKCA (Phospho-Thr497) Antibody detects endogenous levels of PRKCA only when phosphorylated at Thr497.

Phospho-PRKCA (Ser657) Antibody

AF8396 200ul
EUR 376.00
Description: PRKCA (Phospho-Ser657) Antibody detects endogenous levels of PRKCA only when phosphorylated at Ser657.

PRKCA (Phospho- Thr497) Antibody

ABF8395 100 ug
EUR 438.00

PRKCA (Phospho- Ser657) Antibody

ABF8396 100 ug
EUR 438.00

PRKCA Rabbit mAb

A11107-100ul 100 ul
EUR 459.00

PRKCA Rabbit mAb

A11107-200ul 200 ul
EUR 686.00

PRKCA Rabbit mAb

A11107-20ul 20 ul Ask for price

PRKCA Rabbit mAb

A11107-50ul 50 ul
EUR 308.00

PRKCA Rabbit pAb

A13342-100ul 100 ul
EUR 308.00

PRKCA Rabbit pAb

A13342-200ul 200 ul
EUR 459.00

PRKCA Rabbit pAb

A13342-20ul 20 ul
EUR 183.00

PRKCA Rabbit pAb

A13342-50ul 50 ul
EUR 223.00

PRKCA Blocking Peptide

DF6070-BP 1mg
EUR 195.00

PRKCA Rabbit pAb

A0267-100ul 100 ul
EUR 308.00

PRKCA Rabbit pAb

A0267-200ul 200 ul
EUR 459.00

PRKCA Rabbit pAb

A0267-20ul 20 ul
EUR 183.00

PRKCA Rabbit pAb

A0267-50ul 50 ul
EUR 223.00

PRKCA cloning plasmid

CSB-CL018699HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2019
  • Sequence: ATGGCTGACGTTTTCCCGGGCAACGACTCCACGGCGTCTCAGGACGTGGCCAACCGCTTCGCCCGCAAAGGGGCGCTGAGGCAGAAGAACGTGCACGAGGTGAAGGACCACAAATTCATCGCGCGCTTCTTCAAGCAGCCCACCTTCTGCAGCCACTGCACCGACTTCATCTGGG
  • Show more
Description: A cloning plasmid for the PRKCA gene.

PRKCA Blocking Peptide

AF7740-BP 1mg
EUR 195.00

Recombinant Human PRKCA

P0211 100ug
EUR 522.36
  • Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose
  • Reconstitution: Sterile distilled water
  • Purity: Greater than 95% by SDS-PAGE gel analyses
  • Uniprot ID: P17252
Description: Recombinant Human protein for PRKCA

PRKCA (Phospho-Tyr195) Conjugated Antibody

C13096 100ul
EUR 397.00

Anti-PKC alpha/PRKCA Antibody

PA1065 100ug/vial
EUR 334.00

Anti-PKC alpha/PRKCA Antibody

PB9318 100ug/vial
EUR 334.00

Anti-Phospho-PRKCA-(S226) antibody

STJ113497 100 µl
EUR 393.00
Description: Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. This kinase has been reported to play roles in many different cellular processes, such as cell adhesion, cell transformation, cell cycle checkpoint, and cell volume control. Knockout studies in mice suggest that this kinase may be a fundamental regulator of cardiac contractility and Ca(2+) handling in myocytes.

Anti-Phospho-PRKCA-(S319) antibody

STJ117877 100 µl
EUR 393.00
Description: Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. This kinase has been reported to play roles in many different cellular processes, such as cell adhesion, cell transformation, cell cycle checkpoint, and cell volume control. Knockout studies in mice suggest that this kinase may be a fundamental regulator of cardiac contractility and Ca(2+) handling in myocytes.

Polyclonal Mouse Prkca Antibody (N-term)

APR03938G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Mouse Prkca (N-term). This antibody is tested and proven to work in the following applications:

Protein Interacting With Prkca 1 Antibody

20-abx114793
  • EUR 732.00
  • EUR 398.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Protein Kinase C Alpha (PRKCA) Antibody

abx116998-100ug 100 ug
EUR 467.00
  • Shipped within 5-10 working days.

Protein Kinase C Alpha (PRKCA) Antibody

20-abx125382
  • EUR 592.00
  • EUR 857.00
  • EUR 411.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

Protein Kinase C Alpha (PRKCA) Antibody

abx037155-100ug 100 ug
EUR 391.00
  • Shipped within 5-10 working days.

Protein Kinase C Alpha (PRKCA) Antibody

abx034005-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

Protein Kinase C Alpha (PRKCA) Antibody

abx034005-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

Protein kinase C alpha (PRKCA) Antibody

20-abx241740
  • EUR 411.00
  • EUR 300.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Protein kinase C alpha (PRKCA) Antibody

20-abx241741
  • EUR 411.00
  • EUR 300.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Protein kinase C alpha (PRKCA) Antibody

20-abx241990
  • EUR 411.00
  • EUR 300.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Protein kinase C alpha (PRKCA) Antibody

20-abx242373
  • EUR 411.00
  • EUR 300.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Protein kinase C alpha (PRKCA) Antibody

20-abx329052
  • EUR 314.00
  • EUR 244.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Protein kinase C alpha (PRKCA) Antibody

abx332239-100ul 100 ul
EUR 425.00
  • Shipped within 5-10 working days.

Protein kinase C alpha (PRKCA) Antibody

abx332517-100ul 100 ul
EUR 425.00
  • Shipped within 5-10 working days.

Protein kinase C alpha (PRKCA) Antibody

20-abx326423
  • EUR 314.00
  • EUR 244.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Protein kinase C alpha (PRKCA) Antibody

20-abx327945
  • EUR 314.00
  • EUR 244.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Protein Kinase C Alpha (PRKCA) Antibody

20-abx302139
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Protein Kinase C Alpha (PRKCA) Antibody

20-abx000652
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

Anti-Phospho-PRKCA-S657/Y658 antibody

STJ11101090 100 µl
EUR 393.00
Description: Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. This kinase has been reported to play roles in many different cellular processes, such as cell adhesion, cell transformation, cell cycle checkpoint, and cell volume control. Knockout studies in mice suggest that this kinase may be a fundamental regulator of cardiac contractility and Ca(2+) handling in myocytes.

Anti-Phospho-PRKCA/PRKCB-(T641) antibody

STJ22341 100 µl
EUR 393.00
Description: Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. This protein kinase has been reported to be involved in many different cellular functions, such as B cell activation, apoptosis induction, endothelial cell proliferation, and intestinal sugar absorption. Studies in mice also suggest that this kinase may also regulate neuronal functions and correlate fear-induced conflict behavior after stress. Alternatively spliced transcript variants encoding distinct isoforms have been reported.

Human PRKCA ELISA Kit

ELA-E1380h 96 Tests
EUR 824.00

PRKCA ELISA KIT|Human

EF005341 96 Tests
EUR 689.00

Mouse PRKCA shRNA Plasmid

20-abx972057
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Human PRKCA shRNA Plasmid

20-abx953748
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

PRKCA Recombinant Protein (Human)

RP084903 100 ug Ask for price

PRKCA Recombinant Protein (Mouse)

RP164438 100 ug Ask for price

PRKCA Recombinant Protein (Rat)

RP222059 100 ug Ask for price

Polyclonal PRKCA / PKC-Alpha Antibody (aa1-250)

APR03163G 0.05ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PRKCA / PKC-Alpha (aa1-250). This antibody is tested and proven to work in the following applications:

Rabbit Anti-PRKCA monoclonal antibody, clone KG1075

DCABH-6947 100 ul
EUR 777.00

Protein Kinase C Alpha Type (PRKCA) Antibody

20-abx133286
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

Protein Kinase C Alpha Type (PRKCA) Antibody

abx011355-100ug 100 ug
EUR 425.00
  • Shipped within 5-10 working days.

Protein Kinase C Alpha Type (PRKCA) Antibody

20-abx011394
  • EUR 439.00
  • EUR 258.00
  • EUR 77.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

Protein Kinase C Alpha Type (PRKCA) Antibody

20-abx012800
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

Protein Kinase C Alpha Type (PRKCA) Antibody

abx033114-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

Protein Kinase C Alpha Type (PRKCA) Antibody

abx033114-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

Protein Kinase C Alpha (PRKCA) Antibody (HRP)

20-abx314446
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Protein Kinase C Alpha (PRKCA) Antibody (FITC)

20-abx314447
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Protein Kinase C Alpha (PRKCA) Antibody (Biotin)

20-abx314448
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Monoclonal PRKCA Antibody (monoclonal) (M01), Clone: 2F11

AMM03937G 0.1mg
EUR 484.00
Description: A Monoclonal antibody against Human PRKCA (monoclonal) (M01). The antibodies are raised in mouse and are from clone 2F11. This antibody is applicable in WB, IHC and IF, E

Phospho-threonine [T497] PKCalpha (PRKCA) polyclonal antibody

ABP-PAB-11667 100 ug Ask for price
    • Product line: Kinases
    • Brand:

Human PRKCA-binding protein (PICK1)

1-CSB-RP054454h
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • MW: 48.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human PRKCA-binding protein(PICK1),partial expressed in E.coli

Phospho-PRKCA (Tyr195) Blocking Peptide

AF7240-BP 1mg
EUR 195.00

Phospho-PRKCA (Thr497) Blocking Peptide

AF8395-BP 1mg
EUR 195.00

Phospho-PRKCA (Ser657) Blocking Peptide

AF8396-BP 1mg
EUR 195.00

Prkca ORF Vector (Rat) (pORF)

ORF074021 1.0 ug DNA
EUR 506.00

h PRKCA inducible lentiviral particles

LVP219 1x107 IFU/ml x 200ul
EUR 451.00
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, PRKCA, is fully sequence verified and matched to NCBI accession ID: NM_002737

PRKCA ORF Vector (Human) (pORF)

ORF028302 1.0 ug DNA
EUR 405.00

Prkca ORF Vector (Mouse) (pORF)

ORF054814 1.0 ug DNA
EUR 506.00

PRKCA/PRKCB/PRKCD/PRKCE/PRKCH/PRKCQ Polyclonal Antibody

30229-100ul 100ul
EUR 252.00

PRKCA/PRKCB/PRKCD/PRKCE/PRKCH/PRKCQ Polyclonal Antibody

30229-50ul 50ul
EUR 187.00

Anti-PRKCA/PRKCB/PRKCD/PRKCE/PRKCH/PRKCQ antibody

STJ119908 100 µl
EUR 277.00

Phospho-PRKCA-S657/Y658 Rabbit pAb

AP0970-100ul 100 ul
EUR 384.00

Phospho-PRKCA-S657/Y658 Rabbit pAb

AP0970-200ul 200 ul
EUR 554.00

Phospho-PRKCA-S657/Y658 Rabbit pAb

AP0970-20ul 20 ul
EUR 183.00

Phospho-PRKCA-S657/Y658 Rabbit pAb

AP0970-50ul 50 ul
EUR 265.00

Prkca sgRNA CRISPR Lentivector set (Mouse)

K4855101 3 x 1.0 ug
EUR 339.00

Prkca sgRNA CRISPR Lentivector set (Rat)

K6807301 3 x 1.0 ug
EUR 339.00

PRKCA sgRNA CRISPR Lentivector set (Human)

K0003901 3 x 1.0 ug
EUR 339.00

PRKCA sgRNA CRISPR Lentivector set (Human)

K1721501 3 x 1.0 ug
EUR 339.00

PRKCA/PRKCB/PRKCD/PRKCE/PRKCG/PRKCH/PRKCQ/PRKCZ Antibody

1-CSB-PA003800
  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against PRKCA/PRKCB/PRKCD/PRKCE/PRKCG/PRKCH/PRKCQ/PRKCZ. Recognizes PRKCA/PRKCB/PRKCD/PRKCE/PRKCG/PRKCH/PRKCQ/PRKCZ from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000

PRKCA/PRKCB/PRKCD/PRKCE/PRKCH/PRKCQ Polyclonal Conjugated Antibody

C30229 100ul
EUR 397.00

PRKCA / PRKCB / PRKCD / PRKCE / PRKCG / PRKCH / PRKCQ / PRKCZ Antibody

20-abx329612
  • EUR 314.00
  • EUR 244.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Protein kinase C alpha Phospho-Tyr657 (PRKCA pY657) Antibody

20-abx327107
  • EUR 314.00
  • EUR 244.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Protein kinase C alpha Phospho-Thr638 (PRKCA pT638) Antibody

20-abx328538
  • EUR 314.00
  • EUR 244.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Human PRKCA- binding protein, PICK1 ELISA KIT

ELI-22002h 96 Tests
EUR 824.00

Prkca sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4855102 1.0 ug DNA
EUR 154.00

Prkca sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4855103 1.0 ug DNA
EUR 154.00

Leave a Reply

Your email address will not be published. Required fields are marked *