Approaches to know cell biology and virulence of Entamoeba histolytica protozoan

0 Comments
biologiayctma

Understanding the Mechanism of Cell Dying in Gemcitabine Resistant Pancreatic Ductal Adenocarcinoma: A Methods Biology Method

Background: Gemcitabine is the usual chemotherapeutic drug administered in superior Pancreatic Ductal Adenocarcinoma (PDAC). Nevertheless, on account of drug resistance in PDAC sufferers, this remedy has change into much less efficient.

Through the years, scientific trials for the search of discovering novel compounds that can be utilized together with gemcitabine have met little or no success.Goal: To foretell the driving elements behind pancreatic ductal adenocarcinoma, and to know the impact of those elements within the development of the illness and their contribution to cell progress and proliferation. 

Strategies: With the assistance of techniques biology approaches and utilizing gene expression knowledge, which is typically present in abundance, dysregulated components in key signalling pathways had been predicted. Distinguished dysregulated components had been built-in right into a mannequin to simulate and research the impact of gemcitabine-induced hypoxia.

 Outcomes: On this research, a number of transcription elements within the type of key drivers of cancer-related genes had been predicted with the assistance of CARNIVAL, and the impact of gemcitabine-induced hypoxia on the apoptosis pathway was proven to affect the downstream components of two main pathway fashions; EGF/VEGF and TNF signalling pathway. 

Conclusion: It was noticed that EGF/VEGF signalling pathway performed a serious function in inducing drug resistance by means of cell progress, proliferation, and avoiding cell loss of life. Focusing on the key upstream elements of this pathway might probably result in profitable remedy.Key phrases: PDAC; apoptosis; cell loss of life; cell signalling; gemcitabine; hypoxia; techniques biology.  

biologiayctma
biologiayctma

Rabbit Anti Human IgG

E61I00101 100ug
EUR 343

Rabbit anti Human IgG

40C-CB0943 1 mg
EUR 249
Description: Rabbit anti Human IgG secondary antibody

Rabbit anti Human IgG

40C-CB0950 5 mg
EUR 381
Description: Rabbit anti Human IgG secondary antibody

Rabbit anti Human IgG

40C-CB0971 2 mg
EUR 322
Description: Rabbit anti Human IgG secondary antibody

Rabbit anti Human IgM

40C-CB9100 2 mg
EUR 283
Description: Rabbit anti Human IgM secondary antibody

Rabbit anti Human IgA

40C-CB9114 2 mg
EUR 259
Description: Rabbit anti Human IgA secondary antibody

Rabbit anti Human IgE

20-IR77 1 ml
EUR 192
Description: Rabbit anti Human IgE antibody

Rabbit anti-Human CD40 antiserum

CD4011-S 100 ul
EUR 457

Rabbit Anti-Human IgG FC

C020221-1mg 1mg
EUR 269

Rabbit Anti-Human IgG FC

C020221-50mg 50mg
EUR 6015

Rabbit Anti-Human Barttin antiserum

BRTN11-S 100 ul
EUR 457

Rabbit Anti Human IgG-Biotin

E61I00102 1mg
EUR 499

Rabbit Anti Human IgG-HRP

E61I00103 1mg
EUR 499

Rabbit Anti Human IgG-FITC

E61I00104 1mg
EUR 611

Rabbit Anti-Human Iceberg antiserum

ICEBERG11-S 100 ul
EUR 457

Rabbit Anti-Human Endostatin antiserum

ENST11-S 100 ul
EUR 457

Rabbit Anti-Human IgM Antibody

20-abx134798
  • EUR 258.00
  • EUR 342.00
  • 100 ul
  • 500 ul
  • Shipped within 5-10 working days.

Rabbit Anti-Human IgA Antibody

abx019263-01ml 0.1 ml
EUR 328
  • Shipped within 5-10 working days.

Rabbit anti Human IgG (FITC)

43C-CB0944 1 mg
EUR 311
Description: Rabbit anti Human IgG secondary antibody (FITC)

Rabbit anti Human IgG (rhodamine)

43C-CB0945 1 mg
EUR 348
Description: Rabbit anti Human IgG secondary antibody (Rhodamine)

Rabbit anti Human IgG (biotin)

43C-CB0947 1 mg
EUR 340
Description: Rabbit anti Human IgG secondary antibody (biotin)

Rabbit anti Human IgG (HRP)

43C-CB0948 1 mg
EUR 417
Description: Rabbit anti Human IgG secondary antibody (HRP)

Rabbit anti Human IgG (FITC)

43C-CB0951 2 mg
EUR 273
Description: Rabbit anti Human IgG secondary antibody (FITC)

Rabbit anti Human IgG (rhodamine)

43C-CB0952 2 mg
EUR 278
Description: Rabbit anti Human IgG secondary antibody (Rhodamine)

Rabbit anti Human IgG (biotin)

43C-CB0954 2 mg
EUR 340
Description: Rabbit anti Human IgG secondary antibody (biotin)

Rabbit anti Human IgG (HRP)

43C-CB0955 2 mg
EUR 361
Description: Rabbit anti Human IgG secondary antibody (HRP)

Rabbit anti Human IgG (FITC)

43C-CB0965 2 mg
EUR 291
Description: Rabbit anti Human IgG secondary antibody (FITC)

Rabbit anti Human IgG (rhodamine)

43C-CB0966 2 mg
EUR 291
Description: Rabbit anti Human IgG secondary antibody (Rhodamine)

Rabbit anti Human IgG (biotin)

43C-CB0968 2 mg
EUR 359
Description: Rabbit anti Human IgG secondary antibody (biotin)

Rabbit anti Human IgG (HRP)

43C-CB0969 2 mg
EUR 369
Description: Rabbit anti Human IgG secondary antibody (HRP)

Rabbit anti Human IgM (FITC)

43C-CB9101 1.5 mg
EUR 315
Description: Rabbit anti Human IgM secondary antibody (FITC)

Rabbit anti Human IgM (rhodamine)

43C-CB9102 1.5 mg
EUR 302
Description: Rabbit anti Human IgM secondary antibody (Rhodamine)

Rabbit anti Human IgM (biotin)

43C-CB9104 1.5 mg
EUR 357
Description: Rabbit anti Human IgM secondary antibody (biotin)

Rabbit anti Human IgM (HRP)

43C-CB9105 1.5 mg
EUR 392
Description: Rabbit anti Human IgM secondary antibody (HRP)

Rabbit anti Human IgA (FITC)

43C-CB9115 1 mg
EUR 294
Description: Rabbit anti Human IgA secondary antibody (FITC)

Rabbit anti Human IgA (rhodamine)

43C-CB9116 1 mg
EUR 301
Description: Rabbit anti Human IgA secondary antibody (Rhodamine)

Rabbit anti Human IgA (biotin)

43C-CB9118 1 mg
EUR 361
Description: Rabbit anti Human IgA secondary antibody (biotin)

Rabbit anti Human IgA (HRP)

43C-CB9119 1 mg
EUR 368
Description: Rabbit anti Human IgA secondary antibody (HRP)

Rabbit Anti-human CYP1B1 antiserum

CYP1B11-S 100 ul
EUR 457

pAb rabbit anti-human EPO

CT282 0.5 mg
EUR 184

Rabbit Anti-Human Parkin antiserum

PARK11-S 100 ul
EUR 457

Rabbit Anti-Human Livin antiserum

LIVN11-S 100 ul
EUR 457

Rabbit Anti-Human Sialin antiserum

SIAL11-S 100 ul
EUR 457

Anti-CD63 Antibody (rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-CD63A-1 25 ul
EUR 219
  • Category: Exosomes

Anti-CD81 Antibody (rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-CD81A-1 25 ul
EUR 219
  • Category: Exosomes

Anti-CD9 Antibody (rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-CD9A-1 25 ul
EUR 219
  • Category: Exosomes

Anti-Hsp70 Antibody (rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-Hsp70A-1 25 ul
EUR 219
  • Category: Exosomes

Rabbit anti Bovine

E61I02501 0.1mg
EUR 343

UltraTek Anti-Rabbit

ABK008 8 ml
EUR 80

UltraTek Anti-Rabbit

ABK015 15 ml
EUR 98

UltraTek Anti-Rabbit

ABK125 125 ml
EUR 228

UltraTek Anti-Rabbit

ABK500 500 ml
EUR 554

UltraTek Anti-Rabbit

ABK999 1000 ml
EUR 934

SensiTek Anti-Rabbit

ABE008 8 ml
EUR 71

SensiTek Anti-Rabbit

ABE015 15 ml
EUR 80

SensiTek Anti-Rabbit

ABE125 125 ml
EUR 176

SensiTek Anti-Rabbit

ABE500 500 ml
EUR 420

SensiTek Anti-Rabbit

ABE999 1000 ml
EUR 711

Anti-Rabbit antibody

STJ11100323 100 µl
EUR 277

Anti-ALIX Antibody (rabbit anti-human, mouse, rat) with goat anti-rabbit HRP secondary antibody

EXOAB-ALIX-1 25 ul
EUR 219

Anti-ANXA5 Antibody (rabbit anti-human, mouse, rat) with goat anti-rabbit HRP secondary antibody

EXOAB-ANXA5-1 25 ul
EUR 219

Anti-CXCR4 Antibody (rabbit anti-human, mouse, rat) with goat anti-rabbit HRP secondary antibody

EXOAB-CXCR4-1 25 ul
EUR 219

Anti-EpCam Antibody (rabbit anti-human, mouse, rat) with goat anti-rabbit HRP secondary antibody

EXOAB-EPCAM1-1 25 ul
EUR 219

Anti-FLOT1 Antibody (rabbit anti-human, mouse, rat) with goat anti-rabbit HRP secondary antibody

EXOAB-FLOT1-1 25 ul
EUR 219

Anti-TSG101 Antibody (rabbit anti-human, mouse, rat) with goat anti-rabbit HRP secondary antibody

EXOAB-TSG101-1 25 ul
EUR 219

Anti-Vimentin Antibody (rabbit anti-human, mouse, rat) with goat anti-rabbit HRP secondary antibody

EXOAB-VMTN-1 25 ul
EUR 219

Rabbit Anti-Human Plasma Albumin IgG

ALBH12-A 100 ul
EUR 408

Rabbit Anti-Human Amylin antiserum # 2

AMYL12-S 100 ul
EUR 457

Rabbit Anti-Human SMAD6 polyclonal antibody

CABT-BL001 100 ul
EUR 585

Rabbit Anti-Human GEN1 polyclonal antibody

CABT-BL002 100 ul
EUR 585

Rabbit Anti-Human STX8 polyclonal antibody

CABT-BL003 100 ul
EUR 585

Rabbit Anti-Human KIR3DL3 polyclonal antibody

CABT-BL004 100 ul
EUR 585

Rabbit Anti-Human PCDH15 polyclonal antibody

CABT-BL005 100 ul
EUR 585

Rabbit Anti-Human HGFAC polyclonal antibody

CABT-BL006 100 ul
EUR 585

Rabbit Anti-Human TXNL4A polyclonal antibody

CABT-BL007 100 ul
EUR 585

Rabbit Anti-Human PSMB1 polyclonal antibody

CABT-BL008 100 ul
EUR 585

Rabbit Anti-Human MYOC polyclonal antibody

CABT-BL009 100 ul
EUR 585

Rabbit Anti-Human IL12RB1 polyclonal antibody

CABT-BL010 100 ul
EUR 585

Rabbit Anti-Human TAPBP polyclonal antibody

CABT-BL011 100 ul
EUR 585

Rabbit Anti-Human DLGAP5 polyclonal antibody

CABT-BL012 100 ul
EUR 585

Rabbit Anti-Human HSPB2 polyclonal antibody

CABT-BL013 100 ul
EUR 585

Rabbit Anti-Human TCOF1 polyclonal antibody

CABT-BL016 100 ul
EUR 585

Rabbit Anti-Human NEDD9 polyclonal antibody

CABT-BL017 100 ul
EUR 585

Rabbit Anti-Human LRPAP1 polyclonal antibody

CABT-BL018 100 ul
EUR 585

Rabbit Anti-Human MMP25 polyclonal antibody

CABT-BL019 100 ul
EUR 585

Rabbit Anti-Human NTSR1 polyclonal antibody

CABT-BL020 100 ul
EUR 585

Rabbit Anti-Human UBC polyclonal antibody

CABT-BL025 100 ul
EUR 585

Rabbit Anti-Human LRPPRC polyclonal antibody

CABT-BL026 100 ul
EUR 585

Rabbit Anti-Human PTPN23 polyclonal antibody

CABT-BL027 100 ul
EUR 585

Rabbit Anti-Human LPCAT1 polyclonal antibody

CABT-BL028 100 ul
EUR 585

Rabbit Anti-Human SESN3 polyclonal antibody

CABT-BL029 100 ul
EUR 585

Rabbit Anti-Human DDX5 polyclonal antibody

CABT-BL030 100 ul
EUR 585

Rabbit Anti-Human POLD1 polyclonal antibody

CABT-BL031 100 ul
EUR 585

Rabbit Anti-Human KIF2C polyclonal antibody

CABT-BL032 100 ul
EUR 585

Rabbit Anti-Human SKIV2L2 polyclonal antibody

CABT-BL033 100 ul
EUR 585

Rabbit Anti-Human HADHB polyclonal antibody

CABT-BL034 100 ul
EUR 585

Rabbit Anti-Human DAPK1 polyclonal antibody

CABT-BL035 100 ul
EUR 585

Rabbit Anti-Human NFKBIB polyclonal antibody

CABT-BL036 100 ul
EUR 585

Rabbit Anti-Human HELLS polyclonal antibody

CABT-BL037 100 ul
EUR 585

Rabbit Anti-Human RBM3 polyclonal antibody

CABT-BL038 100 ul
EUR 585

Rabbit Anti-Human PRPF4 polyclonal antibody

CABT-BL039 100 ul
EUR 585

Rabbit Anti-Human CLPS polyclonal antibody

CABT-BL040 100 ul
EUR 585

Rabbit Anti-Human SLC26A2 polyclonal antibody

CABT-BL041 100 ul
EUR 585

Rabbit Anti-Human KIF2B polyclonal antibody

CABT-BL042 100 ul
EUR 585

Rabbit Anti-Human HPD polyclonal antibody

CABT-BL043 100 ul
EUR 585

Rabbit Anti-Human BAMBI polyclonal antibody

CABT-BL044 100 ul
EUR 585

Rabbit Anti-Human INTS6 polyclonal antibody

CABT-BL045 100 ul
EUR 585

Rabbit Anti-Human NHLRC1 polyclonal antibody

CABT-BL046 100 ul
EUR 585

Rabbit Anti-Human HUS1B polyclonal antibody

CABT-BL047 100 ul
EUR 585

Rabbit Anti-Human MUS81 polyclonal antibody

CABT-BL048 100 ul
EUR 585

Rabbit Anti-Human RDM1 polyclonal antibody

CABT-BL049 100 ul
EUR 585

Rabbit Anti-Human ATP2B2 polyclonal antibody

CABT-BL050 100 ul
EUR 585

Rabbit Anti-Human DGUOK polyclonal antibody

CABT-BL051 100 ul
EUR 585

Rabbit Anti-Human GABPB1 polyclonal antibody

CABT-BL052 100 ul
EUR 585

Rabbit Anti-Human KCND3 polyclonal antibody

CABT-BL053 100 ul
EUR 585

Rabbit Anti-Human PYCR1 polyclonal antibody

CABT-BL054 100 ul
EUR 585

Rabbit Anti-Human GCA polyclonal antibody

CABT-BL055 100 ul
EUR 585

Rabbit Anti-Human NSUN6 polyclonal antibody

CABT-BL056 100 ul
EUR 585

Rabbit Anti-Human METTL2A polyclonal antibody

CABT-BL058 100 ul
EUR 585

Rabbit Anti-Human TRIAP1 polyclonal antibody

CABT-BL059 100 ul
EUR 585

Rabbit Anti-Human ARHGAP44 polyclonal antibody

CABT-BL060 100 ul
EUR 585

Rabbit Anti-Human KPNA6 polyclonal antibody

CABT-BL061 100 ul
EUR 585

Rabbit Anti-Human GSTM4 polyclonal antibody

CABT-BL062 100 ul
EUR 585

Rabbit Anti-Human SULT1E1 polyclonal antibody

CABT-BL063 100 ul
EUR 585

Rabbit Anti-Human FGFBP1 polyclonal antibody

CABT-BL064 100 ul
EUR 585

Rabbit Anti-Human COQ3 polyclonal antibody

CABT-BL065 100 ul
EUR 585

Rabbit Anti-Human GSDMB polyclonal antibody

CABT-BL066 100 ul
EUR 585

Rabbit Anti-Human PCDHA13 polyclonal antibody

CABT-BL067 100 ul
EUR 585

Rabbit Anti-Human RAB31 polyclonal antibody

CABT-BL068 100 ul
EUR 585

Rabbit Anti-Human LSM11 polyclonal antibody

CABT-BL069 100 ul
EUR 585

Rabbit Anti-Human COX1 polyclonal antibody

CABT-BL070 100 ul
EUR 585

Rabbit Anti-Human CYP3A5 polyclonal antibody

CABT-BL071 100 ul
EUR 585

Rabbit Anti-Human GSTA2 polyclonal antibody

CABT-BL072 100 ul
EUR 585

Rabbit Anti-Human IGSF3 polyclonal antibody

CABT-BL073 100 ul
EUR 585

Rabbit Anti-Human PSTPIP1 polyclonal antibody

CABT-BL074 100 ul
EUR 585

Rabbit Anti-Human CPLX2 polyclonal antibody

CABT-BL075 100 ul
EUR 585

Rabbit Anti-Human CFHR3 polyclonal antibody

CABT-BL076 100 ul
EUR 585

Rabbit Anti-Human CD2AP polyclonal antibody

CABT-BL077 100 ul
EUR 585

Rabbit Anti-Human GABARAPL1 polyclonal antibody

CABT-BL078 100 ul
EUR 585

Rabbit Anti-Human ACAD9 polyclonal antibody

CABT-BL079 100 ul
EUR 585

Rabbit Anti-Human SPICE1 polyclonal antibody

CABT-BL080 100 ul
EUR 585

Rabbit Anti-Human TMEM184A polyclonal antibody

CABT-BL081 100 ul
EUR 585

Rabbit Anti-Human ALDH9A1 polyclonal antibody

CABT-BL082 100 ul
EUR 585

Rabbit Anti-Human KCNS3 polyclonal antibody

CABT-BL083 100 ul
EUR 585

Rabbit Anti-Human MTX1 polyclonal antibody

CABT-BL084 100 ul
EUR 585

Rabbit Anti-Human SSNA1 polyclonal antibody

CABT-BL085 100 ul
EUR 585

Rabbit Anti-Human RUFY2 polyclonal antibody

CABT-BL086 100 ul
EUR 585

Rabbit Anti-Human USP26 polyclonal antibody

CABT-BL087 100 ul
EUR 585

Rabbit Anti-Human TRMT61B polyclonal antibody

CABT-BL088 100 ul
EUR 585

Rabbit Anti-Human Gm13125 polyclonal antibody

CABT-BL089 100 ul
EUR 585

Rabbit Anti-Human ERCC4 polyclonal antibody

CABT-BL090 100 ul
EUR 585

Rabbit Anti-Human MGAT3 polyclonal antibody

CABT-BL091 100 ul
EUR 585

Rabbit Anti-Human KANSL3 polyclonal antibody

CABT-BL092 100 ul
EUR 585

Rabbit Anti-Human CEP57L1 polyclonal antibody

CABT-BL093 100 ul
EUR 585

Rabbit Anti-Human ANKRD28 polyclonal antibody

CABT-BL094 100 ul
EUR 585

Rabbit Anti-Human EME1 polyclonal antibody

CABT-BL095 100 ul
EUR 585

Rabbit Anti-Human ANKRD52 polyclonal antibody

CABT-BL096 100 ul
EUR 585

Rabbit Anti-Human UBE2NL polyclonal antibody

CABT-BL097 100 ul
EUR 585

Rabbit Anti-Human GTF2H4 polyclonal antibody

CABT-BL098 100 ul
EUR 585

Rabbit Anti-Human HRG polyclonal antibody

CABT-BL099 100 ul
EUR 585

Rabbit Anti-Human SLCO1A2 polyclonal antibody

CABT-BL100 100 ul
EUR 585

Rabbit Anti-Human FAM20A polyclonal antibody

CABT-BL101 100 ul
EUR 585

Rabbit Anti-Human PRDM11 polyclonal antibody

CABT-BL102 100 ul
EUR 585

Rabbit Anti-Human POLD4 polyclonal antibody

CABT-BL103 100 ul
EUR 585

Rabbit Anti-Human AQP9 polyclonal antibody

CABT-BL104 100 ul
EUR 585

Rabbit Anti-Human SLC16A11 polyclonal antibody

CABT-BL105 100 ul
EUR 585

Rabbit Anti-Human KCNK9 polyclonal antibody

CABT-BL106 100 ul
EUR 585

Rabbit Anti-Human CDY1 polyclonal antibody

CABT-BL107 100 ul
EUR 585

Rabbit Anti-Human BAZ1A polyclonal antibody

CABT-BL108 100 ul
EUR 585

Rabbit Anti-Human HIST1H2BG polyclonal antibody

CABT-BL109 100 ul
EUR 585

Rabbit Anti-Human GLDC polyclonal antibody

CABT-BL110 100 ul
EUR 585

Rabbit Anti-Human KIR3DS1 polyclonal antibody

CABT-BL111 100 ul
EUR 585

Rabbit Anti-Human TRIP12 polyclonal antibody

CABT-BL112 100 ul
EUR 585

Rabbit Anti-Human CLDND1 polyclonal antibody

CABT-BL120 100 ul
EUR 585

Rabbit Anti-Human RGN polyclonal antibody

CABT-BL121 100 ul
EUR 585

Rabbit Anti-Human UBL3 polyclonal antibody

CABT-BL122 100 ul
EUR 585

Rabbit Anti-Human KCNJ5 polyclonal antibody

CABT-BL123 100 ul
EUR 585

Rabbit Anti-Human CENPK polyclonal antibody

CABT-BL124 100 ul
EUR 585

Rabbit Anti-Human SERPINA12 polyclonal antibody

CABT-BL125 100 ul
EUR 585

Rabbit Anti-Human CNTNAP3 polyclonal antibody

CABT-BL126 100 ul
EUR 585

Rabbit Anti-Human EBNA1BP2 polyclonal antibody

CABT-BL127 100 ul
EUR 585

Rabbit Anti-Human RBM15B polyclonal antibody

CABT-BL128 100 ul
EUR 585

Rabbit Anti-Human DET1 polyclonal antibody

CABT-BL129 100 ul
EUR 585

Rabbit Anti-Human MZT2B polyclonal antibody

CABT-BL130 100 ul
EUR 585

Rabbit Anti-Human DIAPH2 polyclonal antibody

CABT-BL133 100 ul
EUR 585

Rabbit Anti-Human EVPL polyclonal antibody

CABT-BL134 100 ul
EUR 585

Rabbit Anti-Human XPNPEP2 polyclonal antibody

CABT-BL135 100 ul
EUR 585

Rabbit Anti-Human BICD2 polyclonal antibody

CABT-BL136 100 ul
EUR 585

Rabbit Anti-Human IL20RA polyclonal antibody

CABT-BL137 100 ul
EUR 585

Rabbit Anti-Human GNG2 polyclonal antibody

CABT-BL138 100 ul
EUR 585

Rabbit Anti-Human SLC28A3 polyclonal antibody

CABT-BL139 100 ul
EUR 585

Rabbit Anti-Human FCRL4 polyclonal antibody

CABT-BL140 100 ul
EUR 585

Rabbit Anti-Human L3MBTL2 polyclonal antibody

CABT-BL141 100 ul
EUR 585

Rabbit Anti-Human STRIP1 polyclonal antibody

CABT-BL142 100 ul
EUR 585

Rabbit Anti-Human SLC4A5 polyclonal antibody

CABT-BL143 100 ul
EUR 585

Rabbit Anti-Human JMJD8 polyclonal antibody

CABT-BL144 100 ul
EUR 585

Rabbit Anti-Human NOMO1 polyclonal antibody

CABT-BL145 100 ul
EUR 585

Rabbit Anti-Human CRP monoclonal antibody

CABT-BL8427 100 ul
EUR 663

Rabbit Anti-Human CRP monoclonal antibody

CABT-BL8428 100 ul
EUR 663

Rabbit Anti-Human CRP monoclonal antibody

CABT-BL8429 100 ul
EUR 663

Proteomics approaches to know cell biology and virulence of Entamoeba histolytica protozoan parasite

  • Entamoeba histolytica is the primitive eukaryotic parasite accountable of human amoebiasis, a illness characterised by bloody intestinal diarrhea and invasive extraintestinal sickness.
  • The data of the full genome sequence of virulent E. histolytica and associated non-pathogenic species allowed the event of novel genome-wide methodological approaches together with protein expression profiling and mobile proteomics within the so referred to as post-genomic period.
  • Proteomics research have vastly elevated our understanding of the cell biology of this historic parasite.
  • This overview summarizes the present works regarding proteomics research on cell biology, life cycle, virulence and pathogenesis, novel therapies, and protein expression regulation mechanisms in E. histolytica parasite.
  • Additionally, we talk about using proteomics knowledge for the event of novel therapies, the identification of potential illness biomarkers and differential prognosis between species.
  • SIGNIFICANCE: Entamoeba histolytica is the unicellular protozoan parasite accountable of human amoebiasis, a critical illness with worldwide distribution characterised by bloody intestinal diarrhea and invasive extraintestinal sickness together with peritonitis and liver, pulmonary and mind abscesses.
  • The post-genomic period allowed the event of proteomic research together with protein expression profiling and mobile proteomics.
  • These proteomics research have vastly elevated our understanding on cell biology, life cycle (cyst-trophozoite conversion), virulence, pathogenesis, novel therapies, and protein expression regulation mechanisms in E. histolytica.
  • Importantly, proteomics has revealed the identification of proteins associated to novel therapies, and the identification of potential illness biomarkers and proteins with use in prognosis between species.
  • Hopefully within the coming years, and thru using extra subtle omics instruments, together with deep proteomics, a extra full set of proteins concerned within the aforementioned mobile processes might be obtained and thus perceive the biology of this historic eukaryote.

Useful Modules of Minimal Cell Division for Artificial Biology

Mobile replica is without doubt one of the basic hallmarks of life. Due to this fact, the event of a minimal division equipment able to correct genome condensation and group, mid-cell positioning and segregation in area and time, and the ultimate septation course of represent a basic challenge for artificial biology. It’s due to this fact vital to have the ability to engineer such modules for the manufacturing of synthetic minimal cells. 

A bottom-up meeting of molecular machines from bulk biochemicals complemented by in vivo experiments in addition to computational modelling helps to method such key mobile processes. Right here, minimal useful modules concerned in genome segregation and the division equipment and their spatial group and positioning are reviewed, setting into perspective the design of a minimal cell. Moreover, the milestones of latest in vitro reconstitution experiments within the context of cell division are mentioned and their function in shedding mild on basic mobile mechanisms that represent spatiotemporal order is described. Lastly, present challenges within the subject of bottom-up artificial biology in addition to potential future developments towards the event of minimal biomimetic techniques are mentioned. 

PRKCA Antibody

32053-100ul 100ul
EUR 252

PRKCA Antibody

DF6070 200ul
EUR 304
Description: PRKCA Antibody detects endogenous levels of total PRKCA.

PRKCA Antibody

1-CSB-PA898666
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PRKCA. Recognizes PRKCA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:200-1:1000, IHC:1:25-1:100

PRKCA Antibody

1-CSB-PA937356
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PRKCA. Recognizes PRKCA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

PRKCA Antibody

CSB-PA557375-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline , pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antigen Affinity Purified
Description: A polyclonal antibody against PRKCA. Recognizes PRKCA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

PRKCA Antibody

CSB-PA557375-100ul 100ul
EUR 314
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline , pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antigen Affinity Purified
Description: A polyclonal antibody against PRKCA. Recognizes PRKCA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

PRKCA Antibody

1-CSB-PA566617
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PRKCA. Recognizes PRKCA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:200-1:1000, IHC:1:25-1:100

PRKCA Antibody

1-CSB-PA15859A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PRKCA. Recognizes PRKCA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

PRKCA Antibody

1-CSB-PA105506
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PRKCA. Recognizes PRKCA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

PRKCA Antibody

CSB-PA018699KA01HU-
EUR 335
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against PRKCA. Recognizes PRKCA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

PRKCA Antibody

CSB-PA018699KA01HU-100ul 100ul
EUR 389
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against PRKCA. Recognizes PRKCA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

PRKCA Antibody

1-CSB-PA030237
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against PRKCA. Recognizes PRKCA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/5000

PRKCA Antibody

1-CSB-PA030238
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against PRKCA. Recognizes PRKCA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/5000

PRKCA Antibody

1-CSB-PA030239
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against PRKCA. Recognizes PRKCA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/10000

PRKCA Conjugated Antibody

C32053 100ul
EUR 397

Mouse Prkca Antibody

abx027933-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Mouse Prkca Antibody

abx027933-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

PRKCA (pT497) Antibody

abx217939-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

PRKCA (pS657) Antibody

abx217940-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

PRKCA (pY658) Antibody

abx333503-100ul 100 ul
EUR 467
  • Shipped within 5-10 working days.

Anti-PRKCA antibody

STJ25125 100 µl
EUR 277
Description: Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. This kinase has been reported to play roles in many different cellular processes, such as cell adhesion, cell transformation, cell cycle checkpoint, and cell volume control. Knockout studies in mice suggest that this kinase may be a fundamental regulator of cardiac contractility and Ca(2+) handling in myocytes.

Anti-PRKCA antibody

STJ112958 100 µl
EUR 457
Description: Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. This kinase has been reported to play roles in many different cellular processes, such as cell adhesion, cell transformation, cell cycle checkpoint, and cell volume control. Knockout studies in mice suggest that this kinase may be a fundamental regulator of cardiac contractility and Ca(2+) handling in myocytes.

Anti-PRKCA antibody

STJ115305 100 µl
EUR 277
Description: Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. This kinase has been reported to play roles in many different cellular processes, such as cell adhesion, cell transformation, cell cycle checkpoint, and cell volume control. Knockout studies in mice suggest that this kinase may be a fundamental regulator of cardiac contractility and Ca(2+) handling in myocytes.

Prkca/ Rat Prkca ELISA Kit

ELI-04515r 96 Tests
EUR 886

PRKCA siRNA

20-abx929759
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PRKCA siRNA

20-abx929760
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Phospho-PRKCA (Thr497) Antibody

AF8395 200ul
EUR 376
Description: PRKCA (Phospho-Thr497) Antibody detects endogenous levels of PRKCA only when phosphorylated at Thr497.

Phospho-PRKCA (Ser657) Antibody

AF8396 200ul
EUR 376
Description: PRKCA (Phospho-Ser657) Antibody detects endogenous levels of PRKCA only when phosphorylated at Ser657.

Phospho-PRKCA (Tyr195) Antibody

AF7240 200ul
EUR 376
Description: Phospho-PRKCA (Tyr195) Antibody detects endogenous levels of PRKCA only when phosphorylated at Tyr195.

PRKCA (Phospho- Thr497) Antibody

ABF8395 100 ug
EUR 438

PRKCA (Phospho- Ser657) Antibody

ABF8396 100 ug
EUR 438

PRKCA (Phospho-Tyr195) Antibody

13096-100ul 100ul
EUR 252

PRKCA (Phospho-Tyr195) Antibody

13096-50ul 50ul
EUR 187

PRKCA (Ab-657) Antibody

CSB-PA589165-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against PRKCA (Ab-657). Recognizes PRKCA (Ab-657) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

PRKCA (Ab-657) Antibody

CSB-PA589165-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against PRKCA (Ab-657). Recognizes PRKCA (Ab-657) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

PRKCA Antibody, HRP conjugated

1-CSB-PA15859B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PRKCA. Recognizes PRKCA from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PRKCA Antibody, FITC conjugated

1-CSB-PA15859C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PRKCA. Recognizes PRKCA from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PRKCA Antibody, Biotin conjugated

1-CSB-PA15859D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PRKCA. Recognizes PRKCA from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Phospho-PRKCA (Tyr658) Antibody

CSB-PA060190-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
  • Show more
Description: A polyclonal antibody against Phospho-PRKCA (Tyr658). Recognizes Phospho-PRKCA (Tyr658) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

Phospho-PRKCA (Tyr658) Antibody

CSB-PA060190-100ul 100ul
EUR 362
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
  • Show more
Description: A polyclonal antibody against Phospho-PRKCA (Tyr658). Recognizes Phospho-PRKCA (Tyr658) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

Phospho-PRKCA (Y657) Antibody

1-CSB-PA030235
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-PRKCA (Y657). Recognizes Phospho-PRKCA (Y657) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

Phospho-PRKCA (T638) Antibody

1-CSB-PA030236
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-PRKCA (T638). Recognizes Phospho-PRKCA (T638) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000

PRKCA Blocking Peptide

AF7740-BP 1mg
EUR 195

PRKCA cloning plasmid

CSB-CL018699HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2019
  • Sequence: ATGGCTGACGTTTTCCCGGGCAACGACTCCACGGCGTCTCAGGACGTGGCCAACCGCTTCGCCCGCAAAGGGGCGCTGAGGCAGAAGAACGTGCACGAGGTGAAGGACCACAAATTCATCGCGCGCTTCTTCAAGCAGCCCACCTTCTGCAGCCACTGCACCGACTTCATCTGGG
  • Show more
Description: A cloning plasmid for the PRKCA gene.

PRKCA Rabbit pAb

A0267-100ul 100 ul
EUR 308

PRKCA Rabbit pAb

A0267-200ul 200 ul
EUR 459

PRKCA Rabbit pAb

A0267-20ul 20 ul
EUR 183

PRKCA Rabbit pAb

A0267-50ul 50 ul
EUR 223

PRKCA Rabbit mAb

A11107-100ul 100 ul
EUR 459

PRKCA Rabbit mAb

A11107-200ul 200 ul
EUR 686

PRKCA Rabbit mAb

A11107-20ul 20 ul Ask for price

PRKCA Rabbit mAb

A11107-50ul 50 ul
EUR 308

PRKCA Rabbit pAb

A13342-100ul 100 ul
EUR 308

PRKCA Rabbit pAb

A13342-200ul 200 ul
EUR 459

PRKCA Rabbit pAb

A13342-20ul 20 ul
EUR 183

PRKCA Rabbit pAb

A13342-50ul 50 ul
EUR 223

PRKCA Blocking Peptide

DF6070-BP 1mg
EUR 195

Recombinant Human PRKCA

P0211 100ug
EUR 522.36
  • Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose
  • Reconstitution: Sterile distilled water
  • Purity: Greater than 95% by SDS-PAGE gel analyses
  • Uniprot ID: P17252
Description: Recombinant Human protein for PRKCA

PRKCA (Phospho-Tyr195) Conjugated Antibody

C13096 100ul
EUR 397

Anti-PKC alpha/PRKCA Antibody

PB9318 100ug/vial
EUR 334

Anti-PKC alpha/PRKCA Antibody

PA1065 100ug/vial
EUR 334

Anti-Phospho-PRKCA-(S226) antibody

STJ113497 100 µl
EUR 393
Description: Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. This kinase has been reported to play roles in many different cellular processes, such as cell adhesion, cell transformation, cell cycle checkpoint, and cell volume control. Knockout studies in mice suggest that this kinase may be a fundamental regulator of cardiac contractility and Ca(2+) handling in myocytes.

Anti-Phospho-PRKCA-(S319) antibody

STJ117877 100 µl
EUR 393
Description: Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. This kinase has been reported to play roles in many different cellular processes, such as cell adhesion, cell transformation, cell cycle checkpoint, and cell volume control. Knockout studies in mice suggest that this kinase may be a fundamental regulator of cardiac contractility and Ca(2+) handling in myocytes.

Polyclonal Mouse Prkca Antibody (N-term)

APR03938G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Mouse Prkca (N-term). This antibody is tested and proven to work in the following applications:

Protein Kinase C Alpha (PRKCA) Antibody

20-abx125382
  • EUR 592.00
  • EUR 857.00
  • EUR 411.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Protein Interacting With Prkca 1 Antibody

20-abx114793
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Protein Kinase C Alpha (PRKCA) Antibody

abx116998-100ug 100 ug
EUR 467
  • Shipped within 5-10 working days.

Protein Kinase C Alpha (PRKCA) Antibody

20-abx000652
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Protein Kinase C Alpha (PRKCA) Antibody

abx037155-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Protein Kinase C Alpha (PRKCA) Antibody

abx034005-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Protein Kinase C Alpha (PRKCA) Antibody

abx034005-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Protein kinase C alpha (PRKCA) Antibody

20-abx326423
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Protein kinase C alpha (PRKCA) Antibody

20-abx327945
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Protein kinase C alpha (PRKCA) Antibody

20-abx329052
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Protein kinase C alpha (PRKCA) Antibody

abx332239-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Protein kinase C alpha (PRKCA) Antibody

abx332517-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Protein kinase C alpha (PRKCA) Antibody

20-abx241740
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Protein kinase C alpha (PRKCA) Antibody

20-abx241741
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Protein kinase C alpha (PRKCA) Antibody

20-abx241990
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Protein kinase C alpha (PRKCA) Antibody

20-abx242373
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Protein Kinase C Alpha (PRKCA) Antibody

20-abx302139
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Phospho-PRKCA-S657/Y658 antibody

STJ11101090 100 µl
EUR 393
Description: Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. This kinase has been reported to play roles in many different cellular processes, such as cell adhesion, cell transformation, cell cycle checkpoint, and cell volume control. Knockout studies in mice suggest that this kinase may be a fundamental regulator of cardiac contractility and Ca(2+) handling in myocytes.

Anti-Phospho-PRKCA/PRKCB-(T641) antibody

STJ22341 100 µl
EUR 393
Description: Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. This protein kinase has been reported to be involved in many different cellular functions, such as B cell activation, apoptosis induction, endothelial cell proliferation, and intestinal sugar absorption. Studies in mice also suggest that this kinase may also regulate neuronal functions and correlate fear-induced conflict behavior after stress. Alternatively spliced transcript variants encoding distinct isoforms have been reported.

Human PRKCA ELISA Kit

ELA-E1380h 96 Tests
EUR 824

PRKCA ELISA KIT|Human

EF005341 96 Tests
EUR 689

Human PRKCA shRNA Plasmid

20-abx953748
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse PRKCA shRNA Plasmid

20-abx972057
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PRKCA Recombinant Protein (Human)

RP084903 100 ug Ask for price

PRKCA Recombinant Protein (Rat)

RP222059 100 ug Ask for price

PRKCA Recombinant Protein (Mouse)

RP164438 100 ug Ask for price

Polyclonal PRKCA / PKC-Alpha Antibody (aa1-250)

APR03163G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PRKCA / PKC-Alpha (aa1-250). This antibody is tested and proven to work in the following applications:

Monoclonal PRKCA Antibody (monoclonal) (M01), Clone: 2F11

AMM03937G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human PRKCA (monoclonal) (M01). The antibodies are raised in mouse and are from clone 2F11. This antibody is applicable in WB, IHC and IF, E

Phospho-threonine [T497] PKCalpha (PRKCA) polyclonal antibody

ABP-PAB-11667 100 ug Ask for price
    • Product line: Kinases
    • Brand:

Protein Kinase C Alpha Type (PRKCA) Antibody

20-abx133286
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Protein Kinase C Alpha Type (PRKCA) Antibody

abx033114-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Protein Kinase C Alpha Type (PRKCA) Antibody

abx033114-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Protein Kinase C Alpha Type (PRKCA) Antibody

abx011355-100ug 100 ug
EUR 425
  • Shipped within 5-10 working days.

Protein Kinase C Alpha Type (PRKCA) Antibody

20-abx011394
  • EUR 439.00
  • EUR 258.00
  • EUR 77.00
  • 100 ug
  • 50 ug
  • 5 ug
  • Shipped within 5-10 working days.

Protein Kinase C Alpha Type (PRKCA) Antibody

20-abx012800
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Protein Kinase C Alpha (PRKCA) Antibody (HRP)

20-abx314446
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Protein Kinase C Alpha (PRKCA) Antibody (FITC)

20-abx314447
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Protein Kinase C Alpha (PRKCA) Antibody (Biotin)

20-abx314448
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Rabbit Anti-PRKCA monoclonal antibody, clone KG1075

DCABH-6947 100 ul
EUR 777

Phospho-PRKCA (Thr497) Blocking Peptide

AF8395-BP 1mg
EUR 195

Phospho-PRKCA (Ser657) Blocking Peptide

AF8396-BP 1mg
EUR 195

Phospho-PRKCA (Tyr195) Blocking Peptide

AF7240-BP 1mg
EUR 195

Human PRKCA-binding protein (PICK1)

1-CSB-RP054454h
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 48.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human PRKCA-binding protein(PICK1),partial expressed in E.coli

PRKCA ORF Vector (Human) (pORF)

ORF028302 1.0 ug DNA
EUR 405

h PRKCA inducible lentiviral particles

LVP219 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, PRKCA, is fully sequence verified and matched to NCBI accession ID: NM_002737

Prkca ORF Vector (Rat) (pORF)

ORF074021 1.0 ug DNA
EUR 506

Prkca ORF Vector (Mouse) (pORF)

ORF054814 1.0 ug DNA
EUR 506

PRKCA ELISA Kit (Human) (OKCD07796)

OKCD07796 96 Wells
EUR 936
Description: Description of target: Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. This kinase has been reported to play roles in many different cellular processes, such as cell adhesion, cell transformation, cell cycle checkpoint, and cell volume control. Knockout studies in mice suggest that this kinase may be a fundamental regulator of cardiac contractility and Ca(2+) handling in myocytes.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 12.2pg/mL

PRKCA ELISA Kit (Mouse) (OKCD07797)

OKCD07797 96 Wells
EUR 818
Description: Description of target: Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab);Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 0.31ng/mL

PRKCA ELISA Kit (Rat) (OKCD07798)

OKCD07798 96 Wells
EUR 1001
Description: Description of target: Displays Ca+2 dependent protein kinase activity;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 0.117ng/mL

PRKCA ELISA Kit (Rat) (OKCA00995)

OKCA00995 96 Wells
EUR 917
Description: Description of target: Calcium-activated, phospholipid- and diacylglycerol (DAG)-dependent serine/threonine-protein kinase that is involved in positive and negative regulation of cell proliferation, apoptosis, differentiation, migration and adhesion, cardiac hypertrophy, angiogenesis, platelet function and inflammation, by directly phosphorylating targets such as RAF1, BCL2, CSPG4, TNNT2/CTNT, or activating signaling cascades involving MAPK1/3 (ERK1/2) and RAP1GAP. Depending on the cell type, is involved in cell proliferation and cell growth arrest by positive and negative regulation of the cell cycle. Can promote cell growth by phosphorylating and activating RAF1, which mediates the activation of the MAPK/ERK signaling cascade, and/or by up-regulating CDKN1A, which facilitates active cyclin-dependent kinase (CDK) complex formation. In cells stimulated by the phorbol ester PMA, can trigger a cell cycle arrest program which is associated with the accumulation of the hyper-phosphorylated growth-suppressive form of RB1 and induction of the CDK inhibitors CDKN1A and CDKN1B. Depending on the cell type, exhibits anti-apoptotic function and protects cells from apoptosis by suppressing the p53/TP53-mediated activation of IGFBP3, or mediates anti-apoptotic action by phosphorylating BCL2. During macrophage differentiation induced by macrophage colony-stimulating factor (CSF1), is translocated to the nucleus and is associated with macrophage development. After wounding, translocates from focal contacts to lamellipodia and participates in the modulation of desmosomal adhesion. Plays a role in cell motility by phosphorylating CSPG4, which induces association of CSPG4 with extensive lamellipodia at the cell periphery and polarization of the cell accompanied by increases in cell motility. Negatively regulates myocardial contractility and positively regulates angiogenesis, platelet aggregation and thrombus formation in arteries. Mediates hypertrophic growth of neonatal cardiomyocytes, in part through a MAPK1/3 (ERK1/2)-dependent signaling pathway, and upon PMA treatment, is required to induce cardiomyocyte hypertrophy up to heart failure and death, by increasing protein synthesis, protein-DNA ratio and cell surface area. Regulates cardiomyocyte function by phosphorylating cardiac troponin T (TNNT2/CTNT), which induces significant reduction in actomyosin ATPase activity, myofilament calcium sensitivity and myocardial contractility. In angiogenesis, is required for full endothelial cell migration, adhesion to vitronectin (VTN), and vascular endothelial growth factor A (VEGFA)-dependent regulation of kinase activation and vascular tube formation. Involved in the stabilization of VEGFA mRNA at post-transcriptional level and mediates VEGFA-induced cell proliferation. In the regulation of calcium-induced platelet aggregation, mediates signals from the CD36/GP4 receptor for granule release, and activates the integrin heterodimer ITGA2B-ITGB3 through the RAP1GAP pathway for adhesion. During response to lipopolysaccharides (LPS), may regulate selective LPS-induced macrophage functions involved in host defense and inflammation. But in some inflammatory responses, may negatively regulate NF-kappa-B-induced genes, through IL1A-dependent induction of NF-kappa-B inhibitor alpha (NFKBIA/IKBA). Upon stimulation with 12-O-tetradecanoylphorbol-13-acetate (TPA), phosphorylates EIF4G1, which modulates EIF4G1 binding to MKNK1 and may be involved in the regulation of EIF4E phosphorylation. Phosphorylates KIT, leading to inhibition of KIT activity. Phosphorylates ATF2 which promotes cooperation between ATF2 and JUN, activating transcription.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 3.9 pg/mL

Prkca ELISA Kit (Rat) (OKEH04840)

OKEH04840 96 Wells
EUR 662
Description: Description of target: Displays Ca+2 dependent protein kinase activity;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.172 ng/mL

Prkca ELISA Kit (Mouse) (OKEH04841)

OKEH04841 96 Wells
EUR 662
Description: Description of target: Calcium-activated, phospholipid- and diacylglycerol (DAG)-dependent serine/threonine-protein kinase that is involved in positive and negative regulation of cell proliferation, apoptosis, differentiation, migration and adhesion, cardiac hypertrophy, angiogenesis, platelet function and inflammation, by directly phosphorylating targets such as RAF1, BCL2, CSPG4, TNNT2/CTNT, or activating signaling cascades involving MAPK1/3 (ERK1/2) and RAP1GAP. Depending on the cell type, is involved in cell proliferation and cell growth arrest by positive and negative regulation of the cell cycle. Can promote cell growth by phosphorylating and activating RAF1, which mediates the activation of the MAPK/ERK signaling cascade, and/or by up-regulating CDKN1A, which facilitates active cyclin-dependent kinase (CDK) complex formation. In cells stimulated by the phorbol ester PMA, can trigger a cell cycle arrest program which is associated with the accumulation of the hyper-phosphorylated growth-suppressive form of RB1 and induction of the CDK inhibitors CDKN1A and CDKN1B. Depending on the cell type, exhibits anti-apoptotic function and protects cells from apoptosis by suppressing the p53/TP53-mediated activation of IGFBP3, or mediates anti-apoptotic action by phosphorylating BCL2. During macrophage differentiation induced by macrophage colony-stimulating factor (CSF1), is translocated to the nucleus and is associated with macrophage development. After wounding, translocates from focal contacts to lamellipodia and participates in the modulation of desmosomal adhesion. Plays a role in cell motility by phosphorylating CSPG4, which induces association of CSPG4 with extensive lamellipodia at the cell periphery and polarization of the cell accompanied by increases in cell motility. Negatively regulates myocardial contractility and positively regulates angiogenesis, platelet aggregation and thrombus formation in arteries. Mediates hypertrophic growth of neonatal cardiomyocytes, in part through a MAPK1/3 (ERK1/2)-dependent signaling pathway, and upon PMA treatment, is required to induce cardiomyocyte hypertrophy up to heart failure and death, by increasing protein synthesis, protein-DNA ratio and cell surface area. Regulates cardiomyocyte function by phosphorylating cardiac troponin T (TNNT2/CTNT), which induces significant reduction in actomyosin ATPase activity, myofilament calcium sensitivity and myocardial contractility. In angiogenesis, is required for full endothelial cell migration, adhesion to vitronectin (VTN), and vascular endothelial growth factor A (VEGFA)-dependent regulation of kinase activation and vascular tube formation. Involved in the stabilization of VEGFA mRNA at post-transcriptional level and mediates VEGFA-induced cell proliferation. In the regulation of calcium-induced platelet aggregation, mediates signals from the CD36/GP4 receptor for granule release, and activates the integrin heterodimer ITGA2B-ITGB3 through the RAP1GAP pathway for adhesion. During response to lipopolysaccharides (LPS), may regulate selective LPS-induced macrophage functions involved in host defense and inflammation. But in some inflammatory responses, may negatively regulate NF-kappa-B-induced genes, through IL1A-dependent induction of NF-kappa-B inhibitor alpha (NFKBIA/IKBA). Upon stimulation with 12-O-tetradecanoylphorbol-13-acetate (TPA), phosphorylates EIF4G1, which modulates EIF4G1 binding to MKNK1 and may be involved in the regulation of EIF4E phosphorylation. Phosphorylates KIT, leading to inhibition of KIT activity. Phosphorylates ATF2 which promotes cooperation between ATF2 and JUN, activating transcription.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15.6 pg/mL

PRKCA ELISA Kit (Bovine) (OKEH06643)

OKEH06643 96 Wells
EUR 779
Description: Description of target: Calcium-activated, phospholipid- and diacylglycerol (DAG)-dependent serine/threonine-protein kinase that is involved in positive and negative regulation of cell proliferation, apoptosis, differentiation, migration and adhesion, cardiac hypertrophy, angiogenesis, platelet function and inflammation, by directly phosphorylating targets such as RAF1, BCL2, CSPG4, TNNT2/CTNT, or activating signaling cascades involving MAPK1/3 (ERK1/2) and RAP1GAP. Depending on the cell type, is involved in cell proliferation and cell growth arrest by positive and negative regulation of the cell cycle. Can promote cell growth by phosphorylating and activating RAF1, which mediates the activation of the MAPK/ERK signaling cascade, and/or by up-regulating CDKN1A, which facilitates active cyclin-dependent kinase (CDK) complex formation. In cells stimulated by the phorbol ester PMA, can trigger a cell cycle arrest program which is associated with the accumulation of the hyper-phosphorylated growth-suppressive form of RB1 and induction of the CDK inhibitors CDKN1A and CDKN1B. Depending on the cell type, exhibits anti-apoptotic function and protects cells from apoptosis by suppressing the p53/TP53-mediated activation of IGFBP3, or mediates anti-apoptotic action by phosphorylating BCL2. During macrophage differentiation induced by macrophage colony-stimulating factor (CSF1), is translocated to the nucleus and is associated with macrophage development. After wounding, translocates from focal contacts to lamellipodia and participates in the modulation of desmosomal adhesion. Plays a role in cell motility by phosphorylating CSPG4, which induces association of CSPG4 with extensive lamellipodia at the cell periphery and polarization of the cell accompanied by increases in cell motility. Negatively regulates myocardial contractility and positively regulates angiogenesis, platelet aggregation and thrombus formation in arteries. Mediates hypertrophic growth of neonatal cardiomyocytes, in part through a MAPK1/3 (ERK1/2)-dependent signaling pathway, and upon PMA treatment, is required to induce cardiomyocyte hypertrophy up to heart failure and death, by increasing protein synthesis, protein-DNA ratio and cell surface area. Regulates cardiomyocyte function by phosphorylating cardiac troponin T (TNNT2/CTNT), which induces significant reduction in actomyosin ATPase activity, myofilament calcium sensitivity and myocardial contractility. In angiogenesis, is required for full endothelial cell migration, adhesion to vitronectin (VTN), and vascular endothelial growth factor A (VEGFA)-dependent regulation of kinase activation and vascular tube formation. Involved in the stabilization of VEGFA mRNA at post-transcriptional level and mediates VEGFA-induced cell proliferation. In the regulation of calcium-induced platelet aggregation, mediates signals from the CD36/GP4 receptor for granule release, and activates the integrin heterodimer ITGA2B-ITGB3 through the RAP1GAP pathway for adhesion. During response to lipopolysaccharides (LPS), may regulate selective LPS-induced macrophage functions involved in host defense and inflammation. But in some inflammatory responses, may negatively regulate NF-kappa-B-induced genes, through IL1A-dependent induction of NF-kappa-B inhibitor alpha (NFKBIA/IKBA). Upon stimulation with 12-O-tetradecanoylphorbol-13-acetate (TPA), phosphorylates EIF4G1, which modulates EIF4G1 binding to MKNK1 and may be involved in the regulation of EIF4E phosphorylation. Phosphorylates KIT, leading to inhibition of KIT activity. Phosphorylates ATF2 which promotes cooperation between ATF2 and JUN, activating transcription.;Species reactivity: Bovine;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 27 pg/mL

PRKCA/PRKCB/PRKCD/PRKCE/PRKCH/PRKCQ Polyclonal Antibody

30229-100ul 100ul
EUR 252

PRKCA/PRKCB/PRKCD/PRKCE/PRKCH/PRKCQ Polyclonal Antibody

30229-50ul 50ul
EUR 187

Anti-PRKCA/PRKCB/PRKCD/PRKCE/PRKCH/PRKCQ antibody

STJ119908 100 µl
EUR 277

Phospho-PRKCA-S657/Y658 Rabbit pAb

AP0970-100ul 100 ul
EUR 384

Phospho-PRKCA-S657/Y658 Rabbit pAb

AP0970-200ul 200 ul
EUR 554

Phospho-PRKCA-S657/Y658 Rabbit pAb

AP0970-20ul 20 ul
EUR 183

Phospho-PRKCA-S657/Y658 Rabbit pAb

AP0970-50ul 50 ul
EUR 265

PRKCA sgRNA CRISPR Lentivector set (Human)

K0003901 3 x 1.0 ug
EUR 339

PRKCA sgRNA CRISPR Lentivector set (Human)

K1721501 3 x 1.0 ug
EUR 339

Prkca sgRNA CRISPR Lentivector set (Mouse)

K4855101 3 x 1.0 ug
EUR 339

Prkca sgRNA CRISPR Lentivector set (Rat)

K6807301 3 x 1.0 ug
EUR 339

PRKCA/PRKCB/PRKCD/PRKCE/PRKCH/PRKCQ Polyclonal Conjugated Antibody

C30229 100ul
EUR 397

Leave a Reply

Your email address will not be published. Required fields are marked *